Labshake search
Citations for Roche :
451 - 500 of 8337 citations for 7 Bromo 2 3 4 5 tetrahydro 1H benzo e 1 4 diazepine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... AP reaction was developed with 4-Nitro blue tetrazolium chloride (NBT, Roche, 11383213001) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP ...
-
bioRxiv - Neuroscience 2019Quote: ... The sections were then stained overnight at 4°C with pre-absorbed AP-conjugated sheep anti-DIG antibody (1:1000, Roche, cat. 11093274910) in PBS containing 0.1% Triton X-100 and 20% horse serum ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were incubated alone or with ipICP4/pICP4 or BSA for 1 h at 4°C and subsequently fluorescence intensity was measured in a LightCycler II (Roche, Milan, Italy) by observing 6-carboxyfluorescein (6-FAM ...
-
bioRxiv - Genetics 2020Quote: ... Proteins were separated by SDS-PAGE on 4-12% Bis-TRIS SDS-polyacrylamide gels (Novex, NP0322BOX) and analysis was done against primary antibodies α-HA (1:1000, Roche, 12CA5) or α-Tub2 (1:4500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were incubated overnight at 4°C in Odyssey blocking buffer containing 0.1% Tween-20 at 4°C and 1/1000 dilution of anti-c-myc mouse monoclonal antibody (Catalogue number 11 667 149 007, Roche, Bâle, Switzerland) or anti-β-tubulin mouse antibody (Catalogue number T9026 ...
-
bioRxiv - Cell Biology 2024Quote: ... the full-length Treacle was amplified by PCR from cDNA with primer set #4 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BglII and BamHI sites respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... digested rotating for 1h at 37°C with 2mg/ml Collagenase/Dispase (Roche) and then filtered twice (100 μm ...
-
bioRxiv - Biophysics 2023Quote: ... the lysate was incubated for 1h with cOmplete His-Tag Purification Resin (Roche) at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... the DNA template was degraded by 1h incubation with 0.2U/µL DNaseI (Roche). Transcription products were loaded on a 1 mL G-25 Superfine Sephadex column (Cytiva ...
-
bioRxiv - Biochemistry 2022Quote: ... or octamer-mix were done at 900 MHz 1H Larmor frequency at 298 K in NMR buffer (25 mM NaPi, pH 7, 5% D2O, with 1x protease inhibitors (complete EDTA-free cocktail, Roche)) with 600 mM NaCl for the titrations with H2A-H2B and H3-H4 and 300 mM NaCl for titration with octamer-mix ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were lysed by sonication and French Press in purification buffer (50mM sodium phosphate buffer pH 7, 300 mM NaCl) supplemented with 5 ug/mL DNaseI (Roche), 5ug/mL RNAse (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: ... These tissues were cut to ∼2mm pieces and incubated for 1h at 37ºC in the enzymatic cocktail containing Colleagenase D (Roche, 1 mg/ml) and DNAse I (Roche ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Cell Biology 2022Quote: ... HUVEC were seeded to confluency on the microelectrodes of the E-plate (E-plate 16, Roche Applied Science). Electrical impedance readings were taken every 2 min for 5h ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 100 mL of cold lysis buffer (50 mM HEPES pH 8, 175 mM NaCl, 5 % glycerol, 1 mM EDTA and 2 tablets of protease inhibitors by Roche). The bacterial solution was then incubated at room temperature (RT ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5 mM tris(2-carboxyethyl)phosphine (TCEP) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation and the proteins in the supernatant were purified by gravity Ni-nitrilotriacetic acid (Ni-NTA ...
-
bioRxiv - Bioengineering 2021Quote: ... S-phase Synchronous HeLa S3 cells were washed with ice-cold 1× PBS and lysed in a swelling buffer (20 mM HEPES, pH 7.5, 2 mM MgCl2, 5 mM KCl, 1 mM Dithiothreitol [DTT], and protease inhibitor cocktail [Roche; #11836170001]) supplemented with energy-regenerating mixture ...
-
bioRxiv - Immunology 2020Quote: ... Cells were cultured for 24 hours in the presence of SARS-CoV-2 specific MPs [1 μg/mL] or 5 μg/mL phytohemagglutinin (PHA, Roche) in 96-wells U-bottom plates at 1×106 PBMCs per well ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 5 mM EGTA, 1 mM DTT, 2 mM MgCl, and one EDTA-free protease inhibitor cocktail tablet; Roche) and sonicated in an ice bath for 6 minutes ...
-
bioRxiv - Immunology 2023Quote: ... tumor tissue was dissected into approximately 1– 5 mm3 fragments and digested with collagenase Type D (2 mg/ml; Roche) and DNase I (1 mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... Membranes were blocked in 5% low-fat milk in TBS-T for 2 hours and probed with 1:5000-diluted mouse anti-GFP (Roche) or rabbit anti-ATG8 (Agrisera ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were immunostained for Ki67 (clone 30-9 at 1:7, Ventana- Roche), CD8 (clone SP57 at 1:7 ...
-
bioRxiv - Neuroscience 2020Quote: ... The cell lysates (1 μg/μL) were enzymatically digested with 50 μg/mL pronase E (Roche) at 37°C for 1 hour followed quenching with protease inhibitors and SDS-PAGE loading buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... Cell-pellets were resuspended in 25 ml PBS and incubated for 30 min at 4 °C in the presence of 1 mg/ml Lysozym and protease inhibitors (Roche Diagnostics, Penzberg, Germany) The cell lysate was cleared by centrifugation at 40000 g for 10 minutes after sonification with a Bandelin Sonapuls HD 2070 (Reichmann Industrieservice ...
-
bioRxiv - Plant Biology 2021Quote: ... pH 7.4) for 30 min and subsequently incubated 1 h with anti-HA-peroxidase high-affinity monoclonal rat antibody (3F10; Roche [catalog no. 12013819001]) diluted 1:1000 in 2.5% (w/v ...
-
bioRxiv - Biochemistry 2020Quote: ... the expression medium containing the secreted fusion protein was supplemented with 1/4 tablet of protease inhibitor (complete EDTA-free protease inhibitor cocktail tablets, Roche Diagnostic GmbH, 45148300) and transferred to a 15 ml Falcon tube containing 200 μl of washed ...
-
bioRxiv - Neuroscience 2019Quote: ... pH 7.4, 150 mM NaCl, 1.5 mM MgCl2, 1 mM EGTA, 10% glycerol, and freshly added phosphatase inhibitors from Roche Applied Science Cat. # 04906837001). Lysed neurons were mixed 3:1 with 4X sample buffer (40% glycerol ...
-
bioRxiv - Plant Biology 2019Quote: ... 4% (w/v) polyvinylpyrrolidone) supplemented with 2x protease inhibitor cocktail without EDTA (#11873580001, Roche) for 1 h at 4°C in an Eppendorf ThermoMixer at 2000 rpm ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were incubated overnight at 4 °C in MABB with anti-fluorescein POD (Roche) at a 1:500 dilution ...
-
bioRxiv - Neuroscience 2019Quote: ... Signals were developed using a mixture of 4-Nitro blue tetrazolium chloride (Roche, 11383213001) and BCIP 4-toluidine salt solution (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... 4% V/V glycerol and Complete Mini Protease inhibitor cocktail tablets (Roche, Basel Switzerland), 1 tablet in 10 mL) ...
-
bioRxiv - Pathology 2021Quote: ... Obex samples had 4 µl of 1000 µg/mL of proteinase K (PK, Roche) (diluted in 1x PBS and 0.5 M EDTA ...
-
bioRxiv - Molecular Biology 2022Quote: ... the mutants were extracted with PBS containing 4 mM digitonin and protease inhibitors (Roche).
-
bioRxiv - Microbiology 2020Quote: ... The membrane was then incubated overnight at 4°C with an anti-GFP (ROCHE Anti-GFP ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 mM DTT and 10 % (v/v) glycerol) supplemented with: cOmplete protease inhibitor (Roche), 1 mM PMSF ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4 °C in MABB with anti-DIG POD (Roche) at a 1:1,000 dilution ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was reverse-transcribed using 2.5×10-4 U/μl hexanucleotide mix (Roche), 0.4mM deoxynucleotide mix (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and digested with digestion buffer (Gibco DMEM/F12, Fisher 11320033; 4 µg/ml Roche Collagenase/Dispase ...
-
bioRxiv - Neuroscience 2019Quote: ... dispase (5 U ml−1; Roche), and deoxyribonuclease II (50 mg ml−1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mg.kg-1 midazolam (Dormicum, Roche), and 0.05 mg.kg-1 fentanyl (Fentanyl ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Developmental Biology 2023Quote: ... HUVEC were seeded at a density of 60,000cells/well of the E-plate (E-plate 16, Roche Applied Science), then electrical impedance readings acquired every 2 min for 24 hr ...
-
bioRxiv - Microbiology 2021Quote: ... The cell lysate was prepared by sonication of 2×108 cells on ice in 100 mM sodium phosphate buffer pH 7 including EDTA-free Complete Protease Inhibitors (Roche) and 0.01% TX-100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were washed in MABTr and then incubated in NBT (nitro blue tetrazolium)/BCIP (bromo-chloro-indolyl-phosphate, Roche) for colour development ...
-
bioRxiv - Bioengineering 2023Quote: ... dissociated at 37°C for 1h in collagenase (0.5 mg/mL, Roche Life Sciences) / DNase (0.19 mg/mL ...
-
bioRxiv - Plant Biology 2023Quote: ... Membrane was pre-hybridized 1h at 50°C in a DIG eazy Hyb (Roche) and then hybridized overnight at 50°C in same buffer using a denatured probe ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...