Labshake search
Citations for Roche :
451 - 500 of 7679 citations for 7 BROMO 2 1 3 BENZOTHIADIAZOLE 4 SULFINIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The nuclei were stained with 4,6 diamine-2-fenilindole (1 μg/ml, DAPI, Roche). Cells were then washed and mounted with Fluorescent mounting medium (Dako).
-
bioRxiv - Microbiology 2020Quote: ... The anesthetic was 2:1 Ketamine hydrochloride® (Pfizer, Spain):Diazepam ® (Roche, Spain).
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM tris(2-carboxyethyl)phosphine [TCEP]) supplemented with EDTA-free protease inhibitors (Roche). The cells were lysed via sonication and lysate was clarified by centrifugation (17,000 rpm for 1 hour at 4°C) ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were blocked for 2 hours in blocking solution (1% blocking reagent; (Roche, 11096176001) in malic acid buffer (0.15M maleic acid ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cell pellets were treated with 1 mL of 2 mg/mL lysozyme (Roche, Switzerland) and incubated at 30 °C for 10 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% penicillin-streptomycin) and treated with 2 units/mL of DNase I (Roche Diagnostics) for 15 minutes at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% penicillin-streptomycin) and treated with 2 units/mL of DNase I (Roche Diagnostics) for 15 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Epidermis was separated from dermis by Dispase 2 (1:100, Roche #04942078001, 20mg/mL), digested in PBS at 37°C for one hour before being peeled off ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM 2-Mercaptoethanol and 6 cOmplete EDTA-free protease inhibitor Cocktail tablets (Roche), pH 8.0) ...
-
bioRxiv - Biochemistry 2024Quote: ... 250 mg of powder was thawed at 4°C followed by resuspension in 1 mL of HIP buffer (40 mM HEPES-KOH pH 7.5, 110 mM KOAc, 2 mM MgCl2, 1% Triton X-100, 0.1% Tween, 1x protease inhibitor cocktail [Roche], 1% solution P, 1 mM DTT). The lysate was next passed through a Whatman 25 mm GD/X Disposable filter (Cat No ...
-
bioRxiv - Cell Biology 2022Quote: ... After three washes with PBS containing 0.5% Tween-20 samples were incubated with fluorescent labelled secondary antibodies containing 4′,6-diamidino-2-phenylindole (DAPI; Roche Cat# 10236276001, 1.0 µg/ml) for 30 min ...
-
bioRxiv - Developmental Biology 2019Quote: ... and detected with the DIG Nucleic Acid Detection Kit (Roche). Wing imaginal discs were mounted in glycerol and imaged with a Nikon E200 bright-field microscope.
-
bioRxiv - Molecular Biology 2019Quote: ... Nucleic acids were removed with 250 U of Benzonase (Roche) for 1 hr at 4° C ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 mM ascorbic acid) containing a protease inhibitor cocktail (Roche). All subsequent steps were conducted on ice ...
-
bioRxiv - Plant Biology 2022Quote: ... and ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail cOmplete (Roche). For blocking and antibody dilutions ...
-
bioRxiv - Microbiology 2019Quote: ... albumin (5 g/L; fraction V, fatty acid-free, Roche) and tyloxapol (0.04%) ...
-
bioRxiv - Neuroscience 2021Quote: ... Okadaic acid (200nM) and a protease inhibitor cocktail (Roche Complete) with a Dounce homogenizer and solubilized for 1 hour rotating at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... albumin (5 g/L; fraction V, fatty acid-free, Roche) and tyloxapol (0.04%) ...
-
bioRxiv - Immunology 2021Quote: ... 0.25% sodium deoxycholic acid and complete protease inhibitor cocktail (Roche), pH 7.5 ...
-
bioRxiv - Bioengineering 2019Quote: ... three times and transferred to a petri-dish containing 2 ml of protease solution (1 mg/ml of 1 unit/mg Dispase II (Roche Diagnostics Corporation ...
-
bioRxiv - Developmental Biology 2019Quote: ... tissues were washed with ice cold PBS and lysed in lysis buffer (1 mM PMSF, 2 mM Na3VO4, 1× protease and phosphatase inhibitor cocktail tablets without EDTA from Roche Applied Science ...
-
bioRxiv - Cancer Biology 2019Quote: ... and then resuspended in lysis buffer (10 mM Hepes-NaOH, 100 mM NaCl, 2 mM EDTA, 1 mM EGTA, 1 mM PMSF, 0.2% SDS, 0.1% sarkozyl, Roche proteases inhibitor). Sonication was performed with a Misonix sonicator (fifteen cycles of 20 seconds sonication interspaced by a pause of 50 seconds) ...
-
bioRxiv - Biochemistry 2022Quote: Proteins were extracted from adherent cells by scraping into extraction buffer (1× LysisM, 1× protease inhibitor cocktail, 2 x phosphatase inhibitor cocktail (all Roche), 2 mM sodium orthovanadate (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... with buffer II with protease inhibitors (8 μg/ml Aprotinin, 10 μg/ml Leupeptin, 1 μg/ml Pepstatin, 1 mM PMSF and 2 tablets cOmplete Mini, EDTA free; Roche) and 2 times flash frozen in liquid Nitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... and low-volume supernatants (90 μL media per well of a 48-well plate) were mixed 1:1 with 2× SDS/PAGE sample buffer containing Complete Mini EDTA-free Protease Inhibitor Mixture (Roche). In experiments where primary hMDMs were plated in a 24-well plate and infected with T4SS-Lp ...
-
bioRxiv - Developmental Biology 2023Quote: ... sections were washed three times with TBST and then incubated with appropriate secondary antibodies (2 µg/mL in TBST / 1% bovine serum albumin (BSA)) and 1 µg/mL DAPI (Roche) for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... Isolated tissue was cut in pieces of 2 cm and digested for 1h at 37°C in a HBSS solution containing 1% P/S and 2 U ml-1 Dispase II (Roche). Epidermal layer was separated from the dermis using two tweezers ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293T cells were co-transfected with sgRNA expression vectors and lentiviral packaging constructs psPAX2 and pMD2.G (VSV-G) in a 2:1:1 ratio using X-tremeGENE 9 DNA Transfection Reagent (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were incubated overnight at 4°C with a 1:2000 dilution of anti-digoxigenin antibody (Roche) in blocking buffer ...
-
bioRxiv - Plant Biology 2022Quote: ... The membranes were probed overnight at 4 °C with anti-GFP primary antibodies (Roche 11814460001; 1:1000) and then with anti-mouse peroxidase-conjugated secondary antibodies (Jackson Immunoresearch # 115-035-146 ...
-
bioRxiv - Developmental Biology 2021Quote: ... They were incubated overnight at 4°C with 1:4000 alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche) in buffer 2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Following an overnight incubation at 4 °C with rat anti-HA (1:500, monoclonal, Roche, Cat # 11867423001) or mouse anti-GAPDH (1:25.000 ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... The samples were then incubated overnight at 4°C with anti-fluorescein-POD (1:2000, Roche, #11426346910).
-
bioRxiv - Microbiology 2023Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Immunology 2019Quote: ... and hematoxylin (4 minute incubation) and Bluing Reagent (4 minute incubation) counterstain (Roche, Ventana Medical Systems ...
-
bioRxiv - Biochemistry 2021Quote: ... except that all digests contained 200 µg/mL fibrils and 40 µg/mL pronase E and that the digest was stopped in each 20 µL aliquot with 2 µL protease inhibitor cocktail solution (1 tablet cOmplete EDTA-free Protease Inhibitor Cocktail, Roche, in 2 ml pure water) instead of PMSF solution ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mg/ml Dispase II (Roche), and 1 mg/ml trypsin inhibitor (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and ∼3 mg DNase I (Roche). MhOR5 was extracted using 0.5% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% NP40 (Roche 11332473001), 3 µL 10% Tween-20 (Roche 11332465001) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and dithiothreitol (Roche, 3483-12-3). Lysates were rocked at 4C for 20 min and centrifuged 10 min at 15,000g ...
-
bioRxiv - Immunology 2023Quote: ... 3 IU/mL erythropoietin (EPO; Roche), 50 ng/mL stem cell factor (SCF ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Cell Biology 2019Quote: ... ∼100 µl glass beads and 100 µl of lysis buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 15 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to each dried pellet ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked with 3% skim milk in TBS for 30 minutes and then probed with mouse anti-GFP (1:1,000, Roche) or rabbit anti-aldolase (Mesén-Ramírez et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 mM KCl, 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 0.1 mM GTP, 3 U/ml benzonase, 1X Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100 µL protein breakage buffer (50 mM Tris-HCl pH 8.0, 1 mM EDTA, 20 mM Tris pH 9.5, 3 mM DTT, 1X cOmplete EDTA-free inhibitor cocktail [Roche]) were added to the samples ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...