Labshake search
Citations for Roche :
451 - 500 of 3121 citations for 6 Oxo 5 6 7 8 tetrahydronaphthalene 2 carbonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellets were lysed in 200μL of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... resuspended in buffer F (20 mM Tris pH 7.5, 100 mM NaCl, 5 mM MgCl2, 2 mM EGTA and Roche cOmplete protease inhibitor) and lysed by fluidizer ...
-
bioRxiv - Cell Biology 2022Quote: ... and then homogenized on a gentleMACS Octo Dissociator (Miltenyi) using the “Protein_01_01” protocol with MACS buffer (5 mM CaCl2, 2 mM EDTA, 1X protease inhibitor (Roche, 05-892-970-001), 3 mM MgAc ...
-
bioRxiv - Biophysics 2021Quote: ... Cell pellets were resuspended in Lysis Buffer (25 mM HEPES pH 8.0, 250 mM NaCl, 10 mM imidazole pH 8.0, 5 mM 2-mercaptoethanol, 10% glycerol and supplemented with Roche cOmplete protease inhibitor) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pellet was resuspended in Buffer B (10 mM Pipes, 50 mM KCl, 5 mM MgCl2, 1 mM DTT, 2 mM PMSF, Roche protease inhibitor) with 1% Triton X-100 and incubated on ice for 1 hour ...
-
bioRxiv - Physiology 2023Quote: ... autofluorescence was quenched by treating paraffin-embedded sections with PBS/BSA (5%) for 2 h before performing TUNEL staining (Roche, Basel, Switzerland) according to the manufacturer’s protocol and using Proteinase K treatment ...
-
bioRxiv - Cancer Biology 2021Quote: ... 20mM Tris-HCl pH 8) supplemented with protease inhibitors (Roche, 04693116001), followed by a final washing step with TE 1X buffer ...
-
bioRxiv - Biochemistry 2019Quote: ... pH 8) containing complete protease inhibitor (in 50ml) cocktail (Roche Molecular) and disintegrated with a French press (1100 psi) ...
-
bioRxiv - Cell Biology 2020Quote: ... the specimen was digested in 8 mg/mL Collagenase D (Roche) and 4.8 U/mL Dispase II (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 8] with EDTA-free Protease Inhibitor Cocktail (Roche, Basel, Switzerland) and were clarified by centrifugation ...
-
bioRxiv - Molecular Biology 2019Quote: ... all at pH 8) supplemented with a phosphatase (Roche, Basel, Switzerland) and protease inhibitor cocktail (Roche) ...
-
bioRxiv - Neuroscience 2019Quote: ... 8 U/ml RNAse inhibitor and a protease inhibitor cocktail (Roche). Cell debris and nuclei were removed by centrifugation at 1000 g for 10 min at 4°C yielding pellet P1 and supernatant S1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... pH 8 with added inhibitors (cOMPLETE™ tablets, EDTA-free, Roche), DNAse (1 mg/ml) ...
-
bioRxiv - Cancer Biology 2019Quote: ... with filters (8-μm pore size) pre-coated with fibronectin (Roche). APOC2 overexpressing cells ...
-
bioRxiv - Neuroscience 2021Quote: ... 20 mM Tris HCl pH 8 with protease inhibitor cocktail (Roche) and assayed for protein concentration by the BCA assay (Pierce) ...
-
bioRxiv - Biophysics 2023Quote: ... pH 8) with cOmplete EDTA-free protease inhibitor cocktail (11873580001, Roche), 70 µg/mL lysozyme (90082 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were immunostained for Ki67 (clone 30-9 at 1:7, Ventana- Roche), CD8 (clone SP57 at 1:7 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’ RACE was performed with the 5’ RACE kit (Roche) using gene-specific reverse primers ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µl of 5 x KAPA HiFi buffer (Roche, #KK2101) and 16.75 µl H2O ...
-
bioRxiv - Microbiology 2021Quote: ... The infected PBMCs and CD4+ T cells were cultured at 37ºC in humidified air with 5% CO2 in the presence of 20 U/mL of IL-2 (Roche Diagnosis, Indianapolis, IN, USA), with various concentrations of S100A8 or S100A9 in RPMI-140 (Thermo Fisher ...
-
bioRxiv - Genomics 2020Quote: ... Muscles were digested with 8 mg/ml Collagenase D (Roche, Basel, Switzerland) and 10 U/ml Dispase II (Roche ...
-
bioRxiv - Molecular Biology 2021Quote: ... which had been pre-treated with 8 μg/ml mitomycin C (Roche). Throughout the immortalization process ...
-
An optimized ChIP-Seq framework for profiling of histone modifications in Chromochloris zofingiensisbioRxiv - Genomics 2021Quote: ... The ligated products were enriched with 8 cycles of PCR (KAPA biosystems) and size selected to 200-500 bp with Total Pure NGS beads (Omega Bio-tek) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 8 M Urea loading dye was supplemented with complete protease inhibitor (Roche). 100 μl Urea loading dye were used to resuspend cell pellet after NaOH treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... which had been pre-treated with 8 μg/ml mitomycin C (Roche). Throughout the immortalization process ...
-
bioRxiv - Systems Biology 2023Quote: ... Muscles were digested with 8 mg/ml Collagenase D (Roche, Basel, Switzerland) and 10 U/ml Dispase II (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris pH 8 in water) with Protease inhibitors (Roche, 11836170001). WCL lysate was incubated on ice for 30 min and centrifuged at max speed for 10 min to remove debris ...
-
bioRxiv - Cancer Biology 2023Quote: ... 50mM Tris-HCl (pH 8) + protease inhibitor cocktail (PIC, cOmplete Mini, Roche)] and sonicated under optimized conditions that yielded an average DNA length of ∼300 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 8) supplemented with cOmplete™ EDTA-free protease inhibitor tablets (Roche) and Benzonase® nuclease ...
-
Dysregulated expanded endocannabinoid system as therapeutic targets of amyotrophic lateral sclerosisbioRxiv - Neuroscience 2024Quote: Cell viability assays were performed using a WST-8 kit (Roche Diagnostics) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... 8 M Urea and 1x cOmpleteTM EDTA-free protease inhibitor (Roche #11873580001). Lysates were sonicated with a probe sonicator and cleared via centrifugation at 15,000x g for 30 min ...
-
bioRxiv - Bioengineering 2020Quote: ... ITS (5 μg/mL insulin, 5 μg/mL transferrin and 5 ng/mL sodium selenite; Roche Diagnostics GmbH), and 5 % fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mM EDTA pH 8) in presence of Complete Protease Inhibitor Cocktail (Roche) and Halt Phosphatase Inhibitor Cocktail (Pierce) ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 8) containing one tablet of cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). Cells were lysed via two passages through a French pressure cell at 1,500 psi ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the remaining 21865 reads (∼8 Mb) were submitted for assembly by Newbler (Roche). Of the 6309 obtained contigs (N50 = 663 bp) ...
-
bioRxiv - Microbiology 2021Quote: ... pH 8 (buffer A) supplemented with EDTA free complete protease inhibitor tablets (Roche). The cells were lysed using a French press at 18000 psi ...
-
bioRxiv - Cell Biology 2022Quote: Conjugation of protein or nanobody was performed with an 8-fold (Laminin; Roche) or 4-fold (R2-myc-his ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5% blocking reagent (Roche) containing 2.5 μg ml-1 Cy-3-labelled telomere specific (CCCTAA ...
-
bioRxiv - Physiology 2023Quote: ... 5% blocking reagent (Roche), with 1.0 μg/mL of Cy3-labeled telomere-specific (CCCTAA ...
-
bioRxiv - Cell Biology 2023Quote: ... X100)/5% BSA (Roche, 10735086001) for 1 hour at RT ...