Labshake search
Citations for Roche :
451 - 500 of 2634 citations for 6 Chloro 4 methyl 1H pyrrolo 3 2 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Neuroscience 2021Quote: ... 5mM K4Fe(CN)6 and 1 mg/mL of X-gal (Roche) until precipitate was sufficient to visualize ...
-
bioRxiv - Developmental Biology 2020Quote: ... Paired guide-RNA plasmids were transfected into ESCs using FUGENE 6 (Roche) transfection reagent following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... 6 μM EF-Tu was pre-incubated with 1 mM GTP (Roche) in Reaction Buffer for 5 minutes at 37°C and then was supplemented with 4 μM Val-tRNAVal (all final concentrations) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was stained for 6 min with 0.5 μg/ml DAPI (Roche) and coverslips mounted in Vectashield (Vector H-1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 % Igepal CA630) supplemented with 50 μl 6 x Complete (Roche, 04693132001) and 3 μl protease inhibitor (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: U2OS cells were transfected with the indicated plasmids with Fugene 6 (Roche) according to manufacturer’s instructions using a 3:1 Fugene/plasmid ratio ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 mg/ml dispase II (Roche Diagnostics) in CMF Hank’s solution ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Cell Biology 2021Quote: ... Muscles were dissociated and digested in RPMI medium containing 0,2% of collagenase B (Roche Diagnostics GmbH 11088815001) at 37°C for 1 hr and passed through a 70 μm and a 30 μm cell strainer (Miltenyi Biotec) ...
-
bioRxiv - Cell Biology 2021Quote: ... pH: 7.25) and finally homogenized in Buffer B with protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN) using a Polytron ...
-
bioRxiv - Genomics 2019Quote: ... were lysed in 100 ul Buffer-B-0.3 (50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 0,3%SDS, 1x protease inhibitors -Roche) and sonicated in a microtube (Covaris ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.05M NaCl) and once with solution B (0.1M NaCl) and then blocked with yeast RNA (Roche, 10109223001). The blocked C1 beads ...
-
bioRxiv - Genetics 2019Quote: ... and RIPA double-detergent buffer (2% deoxycholate, 2% NP40, 2% Triton X-100 in RIPA homogenizing buffer) supplemented with a protease-inhibitor cocktail (Roche). Cells were subsequently incubated on ice for 30 minutes ...
-
bioRxiv - Genetics 2023Quote: ... and RIPA double-detergent buffer (2% deoxycholate, 2% NP-40, 2% Triton X-100 in RIPA homogenizing buffer) supplemented with protease inhibitor cocktail (Roche), as described previously (Kemaladewi et al. ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 mM MgCl2, 2 mM DTT, 2 µM leupeptin, 2 mM PMSF, 250 mM sucrose, and 1× PhosSTOP phosphatase inhibitors [Roche]). The homogenate was centrifuged for 15 min at 10,000 × g at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the gRNA_enrichment1_fw (5’-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTTGTG-GAAAGGACGAAACACCG-3’) and gRNA_enrichment1_rv (5’-CTACACGAC-GCTCTTCCGATCT-3’) primers and the 2x KAPA HiFi HotStart Ready Mix (Roche, Cat. No. KK2601). In a subsequent PCR ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... 5’-ATGGGCACCCAAAACAACAGT-3’ and 5’-GCGGCAGCACATATCCAAAAA-3’) was PCR amplified with a fast-cycling polymerase (KAPA2G Fast HotStart PCR kit, KAPA Biosystems) and a subsequent gel-electrophoresis ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 mM Tris(2-carboxyethyl)phosphine (TCEP) and cOmplete protease inhibitors (Roche). Cells were lysed by sonication and cell debris pelleted at 25,000 rpm for 40 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM Mg(OAc)2 supplemented with phosphatase and protease inhibitors (Roche) (adapted from (29)) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2% blocking reagent (Roche), 20% heat inactivated goat serum and then incubated overnight with anti-DIG antibody (Roche ...
-
bioRxiv - Bioengineering 2022Quote: ... Hydrogels were subsequently placed in Eppendorf tubes containing 0.2 mL DPBS for hydrolysis or 0.02 mg/mL bacterial (Clostridium histolyticum) collagenase (Collagenase B, Roche) in 0.2 mL DPBS for enzymolysis ...
-
bioRxiv - Molecular Biology 2019Quote: Glycated haemoglobin (GHb) was measured in blood collected at cull using a Cobas b 101 POC system (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2019Quote: ... the injured Tibialis Anterior muscles were collected and dissociated in RPMI 1640 containing 0.2% collagenase B (Roche Diagnostics) at 37°C for 1 hour ...
-
bioRxiv - Developmental Biology 2021Quote: On day 0 (start of differentiation) human pluripotent stem cells were treated with 1mg/ml Collagenase B (Roche) for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: ... The cells were lysed with lysis buffer B without DTT supplemented with cOmplete™ Protease Inhibitor cocktail (Roche) and PhosSTOP (Sigma ...
-
bioRxiv - Physiology 2022Quote: ... the muscles were digested in a solution of 10 g/L Collagenase B (11088831001 Roche Canada, Basel, Switzerland) and 4 g/L Dispase II (D4693 Millipore Sigma ...
-
bioRxiv - Synthetic Biology 2023Quote: ... resuspended in 500 μL of Buffer B (30 mM Tris-HCl pH 7.9, 0.5 mM EDTA, antiprotease complete tablets (Roche)) ...
-
bioRxiv - Immunology 2023Quote: ... spleens and were minced and digested in 5 mL of Iscove’s modified Dulbecco’s media (IMDM) + 10% fetal calf serum (FCS) (cIMDM) with 250 μg/mL collagenase B (Roche) and 30 U/mL DNaseI (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2019Quote: ... 4 mg/ ml Catalase (Roche, Cat#10106810001) and 1mM Trolox ((±)-6-Hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid ...
-
bioRxiv - Cell Biology 2019Quote: ... 4 μl 5xTranscriptor RT reaction buffer (Roche), 0.5 μl RNase OUT (Fisher) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and DNase I (4 U/ml; Roche) in RPMI ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 μl of PCR-grade water (Roche), 1 μl of the corresponding primer pair (10 μM each ...