Labshake search
Citations for Roche :
451 - 500 of 1343 citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Amplification involved cDNA (2 μl, 5 ng/μl) in optical 384-well plates (Roche Light Cycler 480 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and supplemented with 5 mM CaCl2 and 15 units of S7 micrococcal nuclease (Roche). Lysates were sonicated for 10 seconds at low power followed by incubation on ice for 30 minutes and clarification by centrifugation at 13,000 x g for 15 minutes at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 5 hours incubation in MTSB containing 2 % BSA containing either an anti-GFP (Roche) or an anti-PIN1 monoclonal antibody at 0.1 % ...
-
bioRxiv - Plant Biology 2021Quote: ... in a total volume of 5 µL and analyzed on a Lightcycler 480 (Roche). Each reaction was done in three technical and three biological repeats ...
-
bioRxiv - Microbiology 2021Quote: ... Western-blot antibody detection was used using antibodies from Roche Diagnostics Mannheim Germany (Anti-HA, mouse monoclonal primary antibody (12CA5 Roche, 5 mg/ml) at a dilution of 1:1000 ...
-
bioRxiv - Physiology 2021Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Cell Biology 2021Quote: Using serum-free media supplemented with 5 g/l BSA fraction V (Roche, #107351080001), islets were pre-treated with 100 nM CCK ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 mM β-mercaptoethanol and the EDTA-free complete ULTRA protease inhibitor cocktail (Roche). Proteins were batch-purified using Ni-NTA agarose resin (Macherey-Nagel ...
-
bioRxiv - Immunology 2022Quote: ... Mouse tail epidermis was separated from dermis by 5 mg/ml Dispase II (Roche) digestion in 37°C for 1 hr ...
-
bioRxiv - Plant Biology 2021Quote: ... 300 nM gene-specific primers and 5 µL SYBR Green Mix (Roche, Mannheim, Germany). Amplification was done using StepOneTM Real-Time PCR System according to the manufacturer’s description (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with 5 mg/ml 41,6-diamidino-2-phenylindole (DAPI; Roche, 1023627600) in PBS for 1 min and coverslips were mounted onto SuperFrost® Plus slides (R ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... supplemented with 5 mM DTT and a protease inhibitor cocktail (Complete EDTA-free, Roche). Spores were transferred to tubes containing Lysing Matrix E (MP Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5% glycerol) supplemented with protease and phosphatase inhibitors (1X EDTA-Free inhibitor cocktail (Roche), 1 mM PMSF ...
-
bioRxiv - Physiology 2020Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Biochemistry 2020Quote: ... 1% NP-40 and 5% glycerol) supplemented with protease inhibitors (Roche Complete EDTA-free). Protein concentrations were determined by bicinchoninic acid assay (BCA protein assay kit ...
-
bioRxiv - Developmental Biology 2020Quote: ... DNA from lysed cells was removed using 5 μl RNAse-free DNAse I (Roche) for every 1 ml dissociate and incubated at 37°C for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM EDTA and EDTA-free Protease Inhibitor Cocktail tablets (Roche AG, Basel, Switzerland). Cell debris was removed by centrifugation (4 °C) ...
-
bioRxiv - Immunology 2020Quote: ... About 2-5 μg of RNA were treated with DNAseI (Roche Diagnostics, Laval, QC) according to the product manual ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of total RNA were treated with recombinant DNase I (Roche Diagnostics Ltd) at 37°C for 30 min and then purified using a standard phenol–chloroform method ...
-
bioRxiv - Genomics 2022Quote: ... We then added 5 μL of KAPA Unique Dual-Indexed Adapters (Roche, cat # 08861919702) diluted to 750 nM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mM EDTA) supplemented with PMSF (1 mM) and Protease Inhibitor Cocktail (Roche #11836170001) followed by sonication of samples (25 % Amplitude for 10 seconds) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... containing 5% fetal bovine serum (FBS; ThermoTrace) and 0.6 μg/ml of Hygromycin (Roche) in a humidified incubator (37°C ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The 10 μl PCR mixture consisted of 5 μl KAPA2G Robust HotStart ReadyMix (Roche), 1 μl molecular grade water ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mM EDTA) supplemented with a protease inhibitor cocktail (Complete, Roche Applied Science, #11836153001) and phosphatase inhibitors (PhosSTOP Sigma #04906837001) ...
-
bioRxiv - Microbiology 2024Quote: ... using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems, Wilmington, MA), 0.3 mM of each primer and 1 µL of DNA template (20 ng µL-1) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Cancer Biology 2024Quote: ... for 5 minutes on ice and re-suspended in DPBS with Protectorase (Roche #3335402001) and Superase (Invitrogen #AM2694 ...
-
bioRxiv - Cell Biology 2023Quote: ... for 5 minutes and hiPSC-CMs were dissociated using 1:200 Liberase TH (Roche) in PBS for 20 min ...
-
Transcriptional analysis in multiple barley varieties identifies signatures of waterlogging responsebioRxiv - Plant Biology 2023Quote: ... Each PCR reaction mix contained 5 μL of 2x SYBR green master 1 (Roche), 1 μL cDNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 mM sodium ortho vanadate (Na3VO4) and Protease Inhibitor cocktail (Roche Cat. No. 04693124001) and Phosphatase inhibitor (Roche Cat ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 units of Micrococcal nuclease (Nuclease S7 Micrococcal Nuclease, cat# 10107921001; Roche Applied Science) with 200 units ExoIII (cat# M0206S ...
-
bioRxiv - Microbiology 2023Quote: ... 5% Glycerol) complemented with lysozyme (0.25 mg/ml; Merk) and cOmplete Protease Inhibitor (Roche). The samples were sonicated and centrifuged at 15,000g for 45 min at 4°C to pellet cell debris ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% nonfat dry milk and proteins detected using monoclonal anti-GFP (Roche), monoclonal anti-PGK (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 mM ethylenediaminetetraacetic acid (EDTA)) supplemented with complete EDTA-free protease inhibitor cocktail (Roche), 1 mM phenylmethylsulfonyl fluoride (PMSF ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM EDTA) supplemented with 1 mM PMSF and protease inhibitor cocktail (Roche #11836170001). To ensure complete lysis ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 5 µl of X-tremeGENE 9 transfection reagent (XTG9-RO Roche, Sigma-Aldrich). Three days after transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mg/mL DNaseI (Gold Biochem) and a single “Complete” protease inhibitor tablet (Roche). Cells were lysed by sonication and the lysate clarified by centrifugation and applied to glutathione agarose (1 mL bed volume ...
-
bioRxiv - Plant Biology 2023Quote: ... before to add chemiluminescent substrate CSPD® (disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2’-(5’-chloro)tricyclo [3.3.1.13,7]decan}-4-yl) phenyl phosphate) (Roche). The chemio-luminescent signal was detected by using a G-Box (Syngene).
-
bioRxiv - Plant Biology 2024Quote: ... 5 mM MgCl2 and 0.1% Nonidet P40) was supplemented with protease inhibitor (Roche Complete) and added to 100 mg of ground tissue ...
-
bioRxiv - Biophysics 2024Quote: ... 5 % (v/v) glycerol supplemented with benzonase and a protease inhibitor cocktail tablet (Roche). The lysate was subsequently cleared by centrifugation at 87,207 x g for 2 hrs at 4 °C using a Sorvall LYNX 6000 centrifuge and a A27-8 x 50 fixed angle rotor (both Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 U of enzyme mix using the Expand Long Template PCR system (Roche). Samples were amplified with the following thermocycler conditions ...
-
bioRxiv - Immunology 2024Quote: ... 5% 2-ME) supplemented with protease and phosphatase inhibitor cocktails (#4693116001, #PHOSS-RO, Roche). A Pierce BCA Protein Assay Kit (#23225 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µL anti-DIG antibody (Anti-digoxigenin-AP fab fragments, Roche, #11093274910; RRID:AB 2734716) was next added to the blocking solution and incubation lasts for 1.5 to 2 hours ...
-
bioRxiv - Physiology 2024Quote: ... and 5- nitro blue tetrazolium/bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) (Roche) as chromogenic substrates ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% Glycerol) supplemented with freshly added cOmplete mini protease inhibitor cocktail (Roche, cat. # 04693124001). The total cell lysate was centrifuged at 5000 rpm for 30 min at 4°C and the supernatant was bound to Glutathione Agarose beads (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2024Quote: ... 5 mM EDTA) plus protease inhibitor mixture (Complete mini tablets; Roche Applied Science, 11836170001) and phosphatase inhibitor mix (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mM EDTA) supplemented with a protease inhibitor cocktail (Complete, Roche Applied Science, #11836153001) and phosphatase inhibitors (PhosSTOP Sigma #04906837001) ...
-
bioRxiv - Cell Biology 2024Quote: ... MCs were incubated with 160 µg/ml of BrdU (5-Brom-2′-desoxyuridin; Roche) for 2 h at 37°C and then washed with PBS and fixed with 4% PFA for 10 min at room temperature ...