Labshake search
Citations for Roche :
451 - 500 of 6653 citations for 4 Triethylsilyl 3 butyn 1 ol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... 4 µL of 0.25 µg/µL trypsin (Roche, sequencing grade) was added to each sample and left overnight at 37 °C.
-
bioRxiv - Molecular Biology 2020Quote: ... and then with DAPI (4′,6-Diamidino-2-phenylindole, Roche) for 15 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 ul of 20 mg/ml proteinase K (Roche 3115801) was added ...
-
bioRxiv - Neuroscience 2024Quote: ... counterstained using the Red Counterstain II kit (4 min, Roche), removed from the automated system and rinsed with distilled water ...
-
bioRxiv - Plant Biology 2024Quote: ... mixed with 4 μL of 25-fold protease inhibitor (Roche), and frozen at 80°C ...
-
bioRxiv - Systems Biology 2024Quote: ... 4 ul of 20 mg/ml proteinase K (Roche 3115836001) was added to the eluates and inputs and incubated at 50°C for 2 hours to cleave away proteins ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4 cOmplete EDTA-free protease inhibitor cocktail tablets (Roche) per 500 mL ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and then treated with 4 μg/mL proteinase K (Roche) before pre- hybridization in 66% formamide and incubation with a mixture of the STBD1 probe with either LC3A ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 5-bromo4-chloro-3-indolyl phosphate toludinium (Roche Diagnostics, Cat. No 11383221001). Images were taken on a Zeiss Axio Compound Light Microscope with Optronics MacroFire Digital Camera.
-
bioRxiv - Developmental Biology 2021Quote: ... 3 % SDS with protease inhibitors (cOmplete Mini EDTA-free Protease Inhibitor Cocktail, Roche) at room temperature for 1 hour in a total volume of 3 mL ...
-
bioRxiv - Cell Biology 2022Quote: ... collected in a 1.5 ml tube and blocked overnight in 3% BSA (Roche) before incubating in primary antibody (3% BSA in PBT ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was extracted from 3 million HEK293T?cells using TriPure reagent (Roche) and purified using RNeasy MinElute Cleanup Kit (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ and 3’ linkers were terminally labelled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 with with 2X cOmplete Protease Inhibitor Cocktail EDTA-free (Roche)) for 8 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted by digesting the RNA with 3 µg RNase A (Roche) and 30U RNase T1 (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... Poly-guanine was added at the cDNAs 3’ end using Terminal Transferase (Roche) and dGTPs ...
-
bioRxiv - Developmental Biology 2023Quote: ... After a brief enzymatic treatment with a cocktail of Liberase Blendzyme 3 (Roche), trypsin B (BI) ...
-
bioRxiv - Biochemistry 2022Quote: ... and 0.2% bromophenol blue) and treated with 3 mg/ml Proteinase K (Roche) for 1 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Each sample was subject to 3 rounds of homogenisation using a MagnaLyser (Roche) at 6,000 rpm for 15 seconds ...
-
bioRxiv - Biophysics 2022Quote: GGCAGCGCTACCATAACGGA-3’) (11) by RT-qPCR was performed using LightCycler 480 II (Roche). GAPDH mRNAs were used as a loading control (14) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Immunology 2024Quote: ... 5’-GGAGACGATCTTACGCACTGA-3’) were designed using the Universal ProbeLibrary software (Roche Life Sciences). Results were normalized to the expression level of the endogenous references genes (TBP ...
-
bioRxiv - Cell Biology 2024Quote: ... diluted in PBS containing 3% Bovine Serum Albumin (BSA; Roche Diagnostics, Basel, Switzerland), were applied onto the coverslips and incubated for 1 h at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... Signals were developed using 4-nitro blue tetrazolium chloride (NBT, Roche) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.25% Triton supplemented with protease inhibitor at 4□°C (Roche, 04693159001) for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with protease inhibitors (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (Roche), benzamidine ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 mM MgSO4) containing Complete Inhibitor Protease Cocktail (Roche, Indianapolis, IN), lysozyme and DNAse ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C overnight and subsequently developed with NBT/BCIP (Roche). For FISH ...
-
bioRxiv - Physiology 2020Quote: ... containing 0.2 mg 4-(2-aminoethyl)-benzene-sulfonyl fluoride (AEBSF, Roche). Serum from blood samples was obtained by centrifugation at 3,000 rpm for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 complete-EDTA protease-inhibitor tablets per 500 mL (Roche). After thawing ...
-
bioRxiv - Immunology 2022Quote: ... nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Roche) for 4 min at room temperature and observed them under a Laserscaing Confocal Microscopy (TCS SP8 STED ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA (4 ng) and LightCycler 480 SYBR Green I Master (Roche) in a final volume of 10 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... or 1µg/mL 4’,6’-diamidine-2’-phenylindole dihydrochloride (DAPI) (Roche).
-
bioRxiv - Neuroscience 2024Quote: ... and detection with 4-Nitro blue tetrazolium chloride (NBT; 11383213001, Roche) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Cancer Biology 2023Quote: ... Immunohistochemistry was performed on 4 μm sections using the BenchmarkUltra (Roche), anti-hCD45 (M0701 ...
-
bioRxiv - Immunology 2023Quote: ... samples were counterstained with 4’,6-Diamidino-2-phenylindol (DAPI, Roche).
-
bioRxiv - Neuroscience 2023Quote: ... 4% BlockAce (DS Pharma Biomedical) and 0.5× Blocking reagent (Roche Diagnostics)] for 1 hr at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... and ligated (T4 Ligase 5 U/µL, 9015-85-4, Roche) with the Xbal+SalI-HF-digested mTurquoise2-plasmid (#118617 ...
-
bioRxiv - Developmental Biology 2024Quote: ... overnight at 4°C following by BM Purple (Roche, Cat. 11442074001) staining to visualize the locations of RNA probes in purple color ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...