Labshake search
Citations for Roche :
451 - 500 of 8513 citations for 2R 5S 5 4 amino 5 fluoro 2 oxopyrimidin 1 2H yl 1 3 oxathiolan 2 yl methyl butyrate WXC04778 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Bioengineering 2020Quote: ... ITS (5 μg/mL insulin, 5 μg/mL transferrin and 5 ng/mL sodium selenite; Roche Diagnostics GmbH), and 5 % fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mM MgCl2, 1 mM EGTA, 0.1% [v/v] NP-40, 1 mM DTT, 5% [v/v] glycerol and Roche Complete Protease Inhibitors) and homogenized using a high-performance disperser (Fisher) ...
-
bioRxiv - Plant Biology 2022Quote: ... 0.2% NP-40, 10% glycerol, 1 mM EDTA, 1 mM PMSF, 20 µM MG132, 5 mM DTT and Roche protease inhibitor #5892953001), and incubated for 1 h on a rotating wheel ...
-
bioRxiv - Plant Biology 2021Quote: Frozen inflorescence tissue was ground with liquid nitrogen and resuspended in lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 5 mM MgCl2, 10% glycerol, 1% IGEPAL, 0.5 mM DTT, 1 mM PMSF, 1X Roche protease inhibitor cocktail) and homogenized with mixing for 15 minutes at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... except that all digests contained 200 µg/mL fibrils and 40 µg/mL pronase E and that the digest was stopped in each 20 µL aliquot with 2 µL protease inhibitor cocktail solution (1 tablet cOmplete EDTA-free Protease Inhibitor Cocktail, Roche, in 2 ml pure water) instead of PMSF solution ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were then treated with DNase-free RNase (Roche; 5 μg.ml-1; 37°C; 30 min) and proteinase K (250 μg.ml-1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5% (v/v) glycerol and 1 mM TCEP containing an EDTA-free protease inhibitor tablet (Roche). The cell suspension was sonicated on ice and clarified by centrifugation at 27,000g for 15 min ...
-
bioRxiv - Neuroscience 2022Quote: ... The membranes were blocked for 1 hour at room temperature with 5% blocking agent (Roche Diagnostic) in TBST (100 rpm shaker) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 mM imidazole] containing 1 mM phenylmethylsulfonyl fluoride (PMSF) and protease inhibitor cocktail (Complete™; Roche), and recombinant proteins were purified by immobilized metal affinity chromatography (TALON ...
-
bioRxiv - Biochemistry 2024Quote: ... in 5 % BSA in room temperature for 1 hour followed by 2.5 ug/ml DAPI (Roche) for 20 minutes ...
-
bioRxiv - Biophysics 2024Quote: ... 5% glycerol) per 1 L of cells with one EDTA-free protease inhibitor cocktail tablet (Roche). Cells were lysed using a Misonix Sonicator 3000 (110 W for 2 min total ON-time ...
-
bioRxiv - Cancer Biology 2023Quote: Du145 (5 × 103) and 22Rv1 (1 × 104) cells were seeded on 96-well E-Plates (Roche). Proliferation was monitored every 1 h and time dependent cell index (CI ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 7.5 supplemented with 5 mM dithiothreitol (DTT) and 1 x cOmplete protease inhibitor cocktail (Roche)) per gram of wet cell paste and incubated for 1 h at 4°C under stirring ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 mM DTT and 1× cOmplete™ EDTA-free Protease Inhibitor Cocktail (Cat. No. 4693132001, Roche)) ...
-
bioRxiv - Immunology 2024Quote: PCLS (4mm diameter) were incubated (37°C, 5% CO2) with 10µL of WST-1 reagent (Roche) in 100µL of culture media for 1 hour ...
-
bioRxiv - Immunology 2024Quote: ... cells were incubated for 1 hour at 37⁰C and 5% CO2 with 10U DNase (Roche) in R10 medium (RPMI 1640 medium containing GlutaMAX from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... The cell pellet was lysed in 200μl of lysis buffer (50 mM Tris pH 8.0, 150 mM NaCl, 5 mM MgAc, 2% digitonin, and 1X Roche EDTA-free protease inhibitor cocktail) by incubating on ice for 30 min and then diluted to 1ml with the lysis buffer containing 0.1% digitonin ...
-
bioRxiv - Molecular Biology 2020Quote: ... P7 primer for the adapter sequence added in the RT step (CAAGCAGAAGACGGCATACGAGAT) and 5 µl of KAPA SYBR FAST qPCR Master Mix (2×) (KAPA BIOSYSTEMS, Wilmington, MA, USA). qPCR was conducted using LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Plant Biology 2023Quote: ... The petioles were recut about 2 mm above original cut while immersed in bleeding buffer and transferred to 2 mL phloem collection buffer (5 mM phosphate buffer, 5mM EDTA and 0.5x protease inhibitor (Roche cOmplete EDTA-free Protease inhibitor)) and incubated for 6 h in humid conditions.
-
bioRxiv - Biophysics 2024Quote: ... base assay medium was prepared by mixing 25 µL of the luciferin/luciferase mixture (2× concentration of CLSII solution in ATP bioluminescence assay kit, Roche, and 5 mM luciferin), 800 µL of the base buffer (380 mM HEPES buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 200 mM NaCl, 2 mM MgAc2, 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]). After 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 mM NaCl; 2 mM MgAc; 1% [w/v] LMNG, 1 mM DTT, 1x complete EDTA-free protease inhibitor cocktail [Roche, Germany]) per 1 g of cell pellet and incubated for 30 min at 4°C ...
-
bioRxiv - Physiology 2024Quote: ... Follicular membranes were removed from isolated oocytes by collagenase treatment (2 mg ml−1; type 1; Sigma-Aldrich or Collagenase-P from Roche) for 3 hr ...
-
bioRxiv - Cell Biology 2024Quote: ... A total of 2 x 109 cells were harvested and washed with equal volume of cold PBS and resuspended in 1 ml lysis buffer (1 x PBS, supplemented with 1% NP40 and 2 x cOmplete, EDTA-free protease inhibitor cocktail (Roche, 11873580001)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... rehydrated in PBST and bleached in formamide bleaching solution (4 hours) (5% formamide - Roche 11814320001), and 1.2% hydrogen peroxide (Sigma H1009) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were then mechanically lysed (MagNAlyzer Roche – 6000 rpm, 1 min on, 2 min off) in the presence of 300 uL acid-washed glass beads (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM Tris(2-carboxyethyl)phosphin (TCEP) with complete EDTA-free protease inhibitor cocktail (Roche) and 10 µg/ml DNAseI (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 mM tris(2-carboxyethyl)phosphine [TCEP]) supplemented with EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation (17,000 rpm for 1 h at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... diluted 2-fold with PBMC culture media and supplemented with 10% WST-1 reagent (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM PMSF) supplemented with 1 protease inhibitor cocktail tablet (cOmplete-EDTA free, Roche, #11836170001) to a final volume of 50 mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... was diluted 1 in 50 in solution consisting of 2 % blocking reagent (Roche ref 11096176001), 1 % goat serum (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... The slides were counterstained with 4,6-diamidino-2-phenylindole (DAPI, 1 μg/ml; Roche, Switzerland) for 20 min ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole; 10236276001, Roche, Basel, Switzerland) for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA was stained using DAPI (4′,6-diamidino-2-phenylindol-dihydrochloride) (Roche, Mannheim, Germany). Slides were examined using an Axio Imager 7.1 microscope (Zeiss ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mycoplasma contamination was excluded by 4’,6-diamidino-2-phenylindole staining (Roche, Basel, Switzerland). Cell lines were authenticated by STR DNA profiling analysis (Leibniz Institute DMSZ ...
-
bioRxiv - Cancer Biology 2020Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/ml SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 0.5% SDS, 0.5% SDO, 1% Triton X-100, 1 mM PMSF, Roche cOmplete Mini Protease Inhibitors 1x), and homogenized (Precellys Evolution ...
-
bioRxiv - Biochemistry 2022Quote: ... The PVDF membrane was blocked with 5% skim milk in TBS for 1 h and incubated with anti-HA-HRP (Roche, 3F10, 1:5000) in 5% milk/TBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... 150 mM NaCl, 1% NP-40, 1 mM EDTA, 5% glycerol, supplemented with 100 U/mL SUPERase-IN and 1X Roche protease inhibitor cocktail) for 10 minutes ...
-
bioRxiv - Synthetic Biology 2021Quote: GST-tagged CBX8 was purified by re-suspending thawed cell pellets in 30 ml of lysis buffer (1× PBS, 5 mM DTT, 1× EDTA free protease inhibitor cocktail (Roche Diagnostics, Indianapolis, IN)) per liter of culture ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were blocked and permeabilized overnight (STORM) or for 2h (STED and LSCM) (1% Roche Western Blotting Reagent (WBR), Merck ...
-
bioRxiv - Pathology 2023Quote: ... The preparations were washed with buffer 1 and incubated for 2h at 37°C with an anti-digoxigenin antibody conjugated to alkaline phosphatase (1:200 in blocking solution; 11093274910, Roche). Next ...