Labshake search
Citations for Merck :
401 - 450 of 685 citations for ssc mir 411 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... the Senescence Cells Histochemical Staining Kit (Merck, UK) was used according to the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2019Quote: The Muse Ki67 Proliferation kit (Merck, Princeton, USA) was used to detect proliferating and non-proliferating cells based on Ki67 expression ...
-
bioRxiv - Microbiology 2022Quote: ... Live/dead Double Staining Kit (Merck Life Sciences) was used to stain cells followed by microscopy ...
-
bioRxiv - Microbiology 2023Quote: ... difficile using the succinate colorimetric assay kit (Merck) according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: A multiplex assay kit (HNABTMAG-68K, Merck Millipore) was used to quantify Aβ40 ...
-
bioRxiv - Microbiology 2024Quote: ... ECL kits and absolute ethanol were from Merck-Millipore (Germany) ...
-
bioRxiv - Molecular Biology 2024Quote: ... LCAT activity assay kit (Sigma-Aldrich MAK107, Merck) was used according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... as per the manufacturer’s protocol (Merck EZChIP kit). Subsequently ...
-
bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
bioRxiv - Microbiology 2022Quote: ... Cytokine and chemokine levels were measured with a commercial rat cytokine/chemokine magnetic bead panel 96-well plate assay kit (Milliplex MAP kit, Merck Millipore), which detects 5 cytokines and chemokines including IP-10/CXCL10 ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Molecular Biology 2019Quote: ... Amplified DNAs were purified with a Wizard SV Gel and PCR Clean-Up System and were used for in vitro transcription with Fluorescein RNA labeling Mix (Merck, #11685619910) and T7 (Merck ...
-
bioRxiv - Plant Biology 2019Quote: ... A 323 bp fragment was amplified from CAM leaf cDNA using high fidelity PCR with KOD Hot Start DNA Polymerase (Merck, Germany). The amplified fragment spanned the 3’ end of the PPC1 coding sequence and extended into the 3’ untranslated region to ensure specificity of the silencing to both of the aforementioned CAM-associated PPC1 gene copies ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Molecular Biology 2021Quote: ... 300-500bp homology fragments were amplified by PCR from iXist-ChrX genomic DNA using FastStart High Fidelity enzyme (Merck Life Science). N-terminal FKBP12F36V fragments were originally amplified originally from pLEX_305-N-dTAG (Addgene #91797 ...
-
bioRxiv - Biochemistry 2023Quote: ... This mix was then deposited in sterilized 5 mm diameter plastic rings cut from PCR tubes (#683201, Greiner bio-one, Merck KGaA) on the surface of a chicken embryo chorioallantoic membrane ...
-
bioRxiv - Cell Biology 2023Quote: Proteins were extracted from 50 hpf zebrafish embryos using the lysis buffer from the calpain 1/2 activity kit (InnoZyme™ Calpain 1/2 Activity Assay Kit CBA054 purchased from Merck Millipore). Protein concentration was adjusted to 2 mg/mL and calpain enzymatic activity was measured in microtubes following the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a Lactate assay kit (MAK064, Merck, Darmstadt, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Duolink® PLA Red Starter Kit (Merck, Cat # DUO92101), which allows for endogenous detection of protein interactions was used to detect ACTN4/NMM IIA interaction ...
-
bioRxiv - Pathology 2020Quote: A Milliplex Magnetic Bead array kit (Merck Millipore, Milan) was used for measuring 30 cytokines ...
-
bioRxiv - Molecular Biology 2022Quote: Millipore Compartment Protein Extraction Kit (Merck-Millipore, Cat. #2145) was used to deplete cytosolic ...
-
bioRxiv - Molecular Biology 2024Quote: ... Following exposure with the enhanced chemiluminescence kit (Merck, USA), the bands were processed using Image J software (National Institutes of Health ...
-
bioRxiv - Molecular Biology 2024Quote: ... The live-dead cell viability assay kit (Merck Millipore), consisting of Calcein AM and Propidium iodide ...
-
bioRxiv - Biochemistry 2024Quote: ... we utilized the His-Bind purification kit (Merck, USA) followed by manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Each of these three amplicons were amplified by Polymerase Chain Reaction (PCR) using the high-fidelity DNA polymerase KOD (Merck, Darmstadt, Germany). The primers used to amplify the three amplicons of the sixteen prototypes were designed with overlapping regions to perform overlapping PCR with primers which included attB1 and attB2 Gateway recombination sites at the forward and reverse primer ...
-
bioRxiv - Biochemistry 2020Quote: DNA encoding for Pry1 and Na-ASP-2 were PCR amplified and cloned into NcoI and XhoI restriction sites of pET22b vector (Novagen, Merck, Darmstadt, Germany), which contains a pelB signal sequence to direct the secretion of expressed protein into the periplasmic space ...
-
bioRxiv - Neuroscience 2022Quote: ... spherical assembloids were collected in a PCR tube and immediately incubated in BBB working medium with 10 μM 4 kDa dextran-FITC (FD4; Merck, cat. #46944) or 10 μM fluorescently labeled human transferrin (Tf488 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... we followed Magna-Chip™ A/G kit (from Merck) protocol ...
-
bioRxiv - Physiology 2019Quote: Plasma insulin was determined using a commercial kit (Merck Millipore) on a MAGPIXTM Multiplex reader and processed using Bio-Plex ManagerTM MP.
-
bioRxiv - Bioengineering 2021Quote: Bromocresol Purple (BCP) Albumin Assay Kit (Sigma-Aldrich, Merck, Germany) performed as per manufacturer’s instructions with plasma samples diluted 5-fold in ultrapure water ...
-
bioRxiv - Microbiology 2021Quote: ... GLP-1 (GLP-1 total ELISA kit, Merck, Darmstadt, Germany) and biochemical parameters including ALT ...
-
bioRxiv - Microbiology 2021Quote: ... following staining with a Gram stain kit (Merck, Darmstadt, Germany).
-
Large-scale conformational changes of FhaC provide insights into the two-partner secretion mechanismbioRxiv - Biophysics 2022Quote: ... the ECL kit of Amersham (Merck, St Quentin-Fallavier, France) and the Amersham Imager 600 (GE ...
-
bioRxiv - Neuroscience 2020Quote: The Black Gold II staining kit (Merck Millipore, Chengdu, China) was used according to the manufacturer’s instructions(Santiago Gonzalez et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... and libraries were extracted using GenElute plasmid miniprep kit (Merck).
-
bioRxiv - Molecular Biology 2023Quote: ... Duolink™ In Situ Probemaker PLUS kit (Merck, DUO92009-1KT) was applied to conjugate PLA oligonucleotides (PLUS ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fixed colonies were stained with the Alkaline Phosphatase kit (Merck) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: A Magna RIP Kit (Cat# 17-704, Merck, Millipore, Germany) was used to perform the RIP assay following the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2023Quote: A chromatin immuno-precipitation Kit (Merck Millipore, Burlington, MA, USA) was used to perform ChIP-qPCR assays ...
-
bioRxiv - Genetics 2023Quote: ... and ESGRO-2i Supplement Kit (1:1000, #ESG1121; Merck KGaA)] in a humidified incubator at 37 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... 900 μL of RIP Immunoprecipitation Buffer (Magna RIP kit, Merck) supplemented with 200 U RNaseIn was mixed with 100 μl of the lysate and this mixture was used to resuspend the antibody-coupled beads ...
-
bioRxiv - Molecular Biology 2023Quote: A Chromatin Immunoprecipitation (ChIP) Assay Kit (Merck Millipore 17-295) was used for all CTCF ChIP experiments following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: Duolink™ In Situ Probemaker PLUS kit (Merck, DUO92009-1KT) was applied to conjugate PLA oligonucleotides (PLUS ...
-
bioRxiv - Plant Biology 2020Quote: ... the ORF of CLEL6 lacking the predicted signal peptide was amplified by PCR from a previous construct and cloned into the NcoI restriction site of pETDuet1 (Novagen/Merck KGaA, Darmstadt, Germany). Correct orientation and translational fusion with the C–terminal His-tag was verified by sequencing ...
-
bioRxiv - Plant Biology 2020Quote: ... ORFs of PSK1 and RGF1 lacking the predicted signal peptides were amplified by PCR from cDNA and cloned into the NcoI restriction site of pETDuet1 (Novagen/Merck KGaA, Darmstadt, Germany). C-terminal His tags were added by including 6 His codons in the reverse PCR primers ...
-
bioRxiv - Plant Biology 2021Quote: ... The dried extracts were dissolved in 350 μl purified water and filtered through MultiScreen PCR-96 Filter Plate membranes (Merck Millipore, Darmstadt, Germany) to remove high-molecular-mass compounds ...
-
bioRxiv - Cell Biology 2023Quote: ... were generated by PCR and cloned into the pFlag-CMV4 plasmid (for N-terminal Flag fusion in mammalian cells, cat#E7158, Merck Millipore, Burlington, MA, USA). CDS of ARVA ...
-
bioRxiv - Cell Biology 2020Quote: ... and subsequent ligation (Rapid DNA Ligation Kit, Roche, Merck, Zug, CH). Then ...
-
bioRxiv - Neuroscience 2021Quote: ... and high-sensitivity GLP1 Active ELISA kit were acquired from Merck Millipore (Billerica ...