Labshake search
Citations for Merck :
201 - 245 of 245 citations for rno mir 125b 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The region was amplified by polymerase chain reaction (PCR) with KOD Hot Start Polymerase (Merck) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The purified PCR product was eluted in 10 µl water (Lichrosolv®; Merck, Darmstadt, Germany).
-
bioRxiv - Synthetic Biology 2021Quote: ... The designed promoters were obtained by either PCR (KOD Hot-Start DNA polymerase, Merck-Millipore). PCR amplification was performed by KOD Hot Start DNA polymerase (Merck Millipore) ...
-
bioRxiv - Microbiology 2022Quote: ... After testing for SARS-CoV-2 by PCR test (COBAS 6800, Merck México, Mexico city), they were classified as positive (AP ...
-
bioRxiv - Genomics 2023Quote: ... yolk sac or tail of embryos with the REDExtract-N-Amp Tissue PCR kit (Merck) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... DNA purification was performed using a SpinPrep™ PCR Clean-up Kit (Merck Millipore, Germany). DNA fragments were assayed by qRT-PCR using the primer sequences listed below ...
-
bioRxiv - Molecular Biology 2024Quote: The strains and samples were extracted using the RED Extract Plant PCR kit from Merck KGaA ...
-
bioRxiv - Cell Biology 2024Quote: ... The full-length MDM2 coding sequence was isolated from Addgene plasmid #16233 (pcDNA3 FRT MDM2) by PCR using the KOD hot start polymerase kit (Merck #71086), using primers that included a 5’ BamHI restriction site ...
-
bioRxiv - Cell Biology 2023Quote: ... All cell lines were tested every 6-12 months either by PCR (LookOut kit, Sigma/Merck) or Mycostrips (Invivogen ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each PCR included a negative control using Milli-Q water (Merck; Rahway, New Jersey, United States) instead of template DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... the region surrounding the gRNA target sites were amplified by PCR with KOD Hot Start Polymerase (Merck) according to manufacturer’s instructions with the following primer pairs ...
-
bioRxiv - Microbiology 2020Quote: ... the SAG1 promoter and the GFP-coding fragment was amplified by PCR using the KOD polymerase (Merck) and the ML2477/ML2664 primers that included regions for integration by double homologous recombination ...
-
bioRxiv - Molecular Biology 2019Quote: ... an EcoRI restriction site was removed by performing a PCR on AT1.03 and AT1.03R122KR126K pDRF-GW using KOD polymerase (Merck-Millipore ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products of control and sort2 were concentrated by using Amicon Ultra-0.5 10K (UFC501096, Merck Millipore), and analyzed by pair-end sequencing using NovaSeq 6000 system (Illumina) ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product was digested with restriction enzymes and then ligated into pET-17b (Merck Millipore, Burlington, MA, USA) to construct the expression vector pStSOR ...
-
bioRxiv - Microbiology 2022Quote: ... hawaiiensis NRRL 15010 were obtained by ligating PCR-amplified gene sequences with linearized pET11a or pET22b vectors (Merck-Novagen), respectively ...
-
bioRxiv - Immunology 2022Quote: ... The catalytically-inactive SPP D219A mutant was created using overlap-extension PCR (25) with KOD Hot Start Polymerase (Merck) and appropriate primers ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting PCR product was digested with XhoI and NcoI and introduced into the pET-28a vector (Merck Millipore). The ModA E165A ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real time quantitative PCR was performed with KAPA SYBR FAST qPCR Master Mix (Sigma-Aldrich - Merck, UK, cat no KK4602) according to manufacturer’s instructions in a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... CDC50.3 and CDC50.4 were generated using a PCR fragment encoding the mAID–HA and the HXGPRT cassette produced using the KOD DNA polymerase (Novagen, Merck) with the vector pTUB1:YFP-mAID-3HA as template and the primers indicated in Table S2 ...
-
bioRxiv - Biochemistry 2022Quote: ... aeruginosa PAO1 served as a template for the amplification of the genes of interest via PCR using the KOD Xtreme polymerase (Novagen/Merck) and cloning primers containing the restriction sites (Eurofins Genomics) ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell debris was removed by centrifugation at 15k g for 1 min and 1 µl of the supernatant was used as template DNA for 25 µl PCR reaction (KOD HotStart, Merck) with primers NbLib-fwd-i (CAGCTGCAGGAAAGCGGCGG ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product was cloned using the hot fusion method (Fu et al., 2014) in pET30a+ vector (Merck, Molsheim France) pre-digested with EcoRI and BglII in order to fusion AgLTP24 with a N-terminal 6XHis flag ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µg of the digested RNA was reverse-transcribed as described above and validated by PCR using the KOD Xtreme HotStart Polymerase Kit (#71975-3; Merck, PCR program ...
-
bioRxiv - Microbiology 2023Quote: ... Regular testing for mycoplasma contamination was performed to confirm contamination free culture using a PCR-detection kit (Sigma-Aldrich/Merck). The details of cell lines are provided in key resources table ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting pellet was retained and subject to extraction following the RED Extract Plant PCR-Kit (Merck KGaA, Darmstadt, Germany) protocol.
-
bioRxiv - Cell Biology 2024Quote: ... Truncated forms were generated by PCR of the entire plasmid except the region to be excluded using KOD HotStart DNA polymerase (Merck) and the forward primers pUL71 295 fwd ...
-
bioRxiv - Molecular Biology 2019Quote: ... Amplified DNAs were purified with a Wizard SV Gel and PCR Clean-Up System and were used for in vitro transcription with Fluorescein RNA labeling Mix (Merck, #11685619910) and T7 (Merck ...
-
bioRxiv - Plant Biology 2019Quote: ... A 323 bp fragment was amplified from CAM leaf cDNA using high fidelity PCR with KOD Hot Start DNA Polymerase (Merck, Germany). The amplified fragment spanned the 3’ end of the PPC1 coding sequence and extended into the 3’ untranslated region to ensure specificity of the silencing to both of the aforementioned CAM-associated PPC1 gene copies ...
-
bioRxiv - Molecular Biology 2021Quote: ... 300-500bp homology fragments were amplified by PCR from iXist-ChrX genomic DNA using FastStart High Fidelity enzyme (Merck Life Science). N-terminal FKBP12F36V fragments were originally amplified originally from pLEX_305-N-dTAG (Addgene #91797 ...
-
bioRxiv - Biochemistry 2023Quote: ... This mix was then deposited in sterilized 5 mm diameter plastic rings cut from PCR tubes (#683201, Greiner bio-one, Merck KGaA) on the surface of a chicken embryo chorioallantoic membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR product was run on an SDS gel and purified using the Agarose Gel DNA extraction kit from Merck (11696505001).
-
bioRxiv - Neuroscience 2024Quote: ... 5 μL of each sample were mixed with 7.5 μL of KAPA probe fast universal real-time PCR master mix (Merck, Darmstadt, Germany) and 2.5 μL of the indicated primer/probe combinations ...
-
bioRxiv - Cell Biology 2020Quote: ... Each of these three amplicons were amplified by Polymerase Chain Reaction (PCR) using the high-fidelity DNA polymerase KOD (Merck, Darmstadt, Germany). The primers used to amplify the three amplicons of the sixteen prototypes were designed with overlapping regions to perform overlapping PCR with primers which included attB1 and attB2 Gateway recombination sites at the forward and reverse primer ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1 μg of RNA was reverse transcribed using a First Strand cDNA Synthesis Kit (K1622; Fermentas, Burlington, ON, Canada) and polymerase chain reaction (PCR) using a SYBR Green qPCR kit (Merck, Darmstadt, Germany) with incubation at 37°C for 60 minutes ...
-
bioRxiv - Biochemistry 2020Quote: DNA encoding for Pry1 and Na-ASP-2 were PCR amplified and cloned into NcoI and XhoI restriction sites of pET22b vector (Novagen, Merck, Darmstadt, Germany), which contains a pelB signal sequence to direct the secretion of expressed protein into the periplasmic space ...
-
bioRxiv - Neuroscience 2022Quote: ... spherical assembloids were collected in a PCR tube and immediately incubated in BBB working medium with 10 μM 4 kDa dextran-FITC (FD4; Merck, cat. #46944) or 10 μM fluorescently labeled human transferrin (Tf488 ...
-
bioRxiv - Microbiology 2021Quote: ... After each PCR step the amplified regions were separated on agarose gel and purified using Illustra GFX™ PCR DNA and Gel Band Purification Kit (Merck KGaA).
-
bioRxiv - Immunology 2021Quote: ... After each PCR step the amplified regions were separated on agarose gel and purified using Illustra GFX™ PCR DNA and Gel Band Purification Kit (Merck KGaA). The last oePCR step was performed to amplify the complete SARS-CoV-2S D19 sequence using primers carrying 15bp long 5’ overhangs homologous to the vector backbone ...
-
bioRxiv - Plant Biology 2020Quote: ... the ORF of CLEL6 lacking the predicted signal peptide was amplified by PCR from a previous construct and cloned into the NcoI restriction site of pETDuet1 (Novagen/Merck KGaA, Darmstadt, Germany). Correct orientation and translational fusion with the C–terminal His-tag was verified by sequencing ...
-
bioRxiv - Plant Biology 2020Quote: ... ORFs of PSK1 and RGF1 lacking the predicted signal peptides were amplified by PCR from cDNA and cloned into the NcoI restriction site of pETDuet1 (Novagen/Merck KGaA, Darmstadt, Germany). C-terminal His tags were added by including 6 His codons in the reverse PCR primers ...
-
bioRxiv - Plant Biology 2021Quote: ... The dried extracts were dissolved in 350 μl purified water and filtered through MultiScreen PCR-96 Filter Plate membranes (Merck Millipore, Darmstadt, Germany) to remove high-molecular-mass compounds ...
-
bioRxiv - Neuroscience 2022Quote: ... The animals used in our experiments were genotyped for expression of the transgene by quantitative PCR (qPCR) using the KAPA Mouse genotyping kit (Merck, Cat# MGKITKB-KK7301), with primer sequence (5’-3’ ...
-
bioRxiv - Genomics 2021Quote: ... PCR products were cleaned up using the illustra™ ExoProStar™ enzymatic PCR and sequence reaction clean kit according to the manufacturer’s instructions (Merck KGaA, Darmstadt, Germany). Cycle sequencing was performed using the BigDye™ Terminator v3.1 Cycle Sequencing kit and products were purified with the BigDye XTerminator™ purification kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... were generated by PCR and cloned into the pFlag-CMV4 plasmid (for N-terminal Flag fusion in mammalian cells, cat#E7158, Merck Millipore, Burlington, MA, USA). CDS of ARVA ...