Labshake search
Citations for Merck :
351 - 400 of 687 citations for hsa mir 33a 3p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Stained sections were washed three times per 10min each and mounted on slides covered with antifade mounting medium (Fluorsave, Merck, Darmstadt, Germany). Stained sections were imaged at 10X using a widefield fluorescence slide scanner microscope (Zeiss Axioscan Z1 ...
-
bioRxiv - Cell Biology 2020Quote: ... The region was amplified by polymerase chain reaction (PCR) with KOD Hot Start Polymerase (Merck) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The purified PCR product was eluted in 10 µl water (Lichrosolv®; Merck, Darmstadt, Germany).
-
bioRxiv - Synthetic Biology 2021Quote: ... The designed promoters were obtained by either PCR (KOD Hot-Start DNA polymerase, Merck-Millipore). PCR amplification was performed by KOD Hot Start DNA polymerase (Merck Millipore) ...
-
bioRxiv - Microbiology 2022Quote: ... After testing for SARS-CoV-2 by PCR test (COBAS 6800, Merck México, Mexico city), they were classified as positive (AP ...
-
bioRxiv - Pathology 2021Quote: ... KAPA SYBR® FAST kit and qPCR kit were purchased from Merck (Darmstadt, Germany). RNeasy Mini kit and QIAcube were obtained from Qiagen (Venlo ...
-
bioRxiv - Genetics 2023Quote: ... a glycerol assay kit (Merck), and a d-gluconic acid/d-glucono-δ-lactone assay kit (Megazyme International) ...
-
bioRxiv - Biochemistry 2023Quote: ... while an ApopTag Kit (Merck) was used to detect apoptotic cells in accordance with the manufacturer’s instructions.
-
bioRxiv - Biophysics 2019Quote: ... ES products from all three days were thawed at 4 °C and pooled to be concentrated 720 times with Amicon® Ultra-15 Centrifugal Filter Unit 10 kDa cut-off (Merck, cat#UFC901024). The concentrate was used for EV separation.
-
bioRxiv - Cell Biology 2020Quote: ... Slides were immersed in Neo-Clear® three times for 5 minutes and then mounted using Neo-mount® mounting medium (Merck Millipore), coverslipped and left to dry overnight in at 42°C.
-
bioRxiv - Biophysics 2022Quote: ... was washed three times in Tris-buffer (pH 7.48) and resuspended in 1 %w/v Pluronic® F-127 (Merck Chemicals GmbH, Germany) Tris-Buffer.
-
bioRxiv - Molecular Biology 2021Quote: ... the reaction mixture was desalted three times and concentrated by ultrafiltration (Ultracel 100 kDa Ultrafiltration disc with 100 mM phosphate buffer, pH 6.9, Merck Millipore, Burlington, MA, USA) to a final volume of 12 ml.
-
bioRxiv - Molecular Biology 2022Quote: ... EB from each microwell were collected by pipetting up and down the medium several times and transferred into Corning® non-treated culture dishes (Merck, CLS430591-500EA) in EB medium containing DMEM/F12 GlutaMAX (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Testes were washed three times (10 min each) with PBS-T and incubated with anti-H4ac (Merck Millipore #06-598, 1/500 dilution), anti-Histones (Millipore #MABE71 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The antibody was washed three times and concentrated at 4 °C using Amicon Ultra-0.5 100 KDa centrifugal filter devices (Merck Millipore, cat. no. UFC100), which remove salts and preservatives (e.g ...
-
bioRxiv - Cell Biology 2023Quote: ... The fixing solution was aspirated and wells washed 3 times in a washing buffer composed of DPBS containing 0.5% of BSA (Merck Life Science, Gillingham, UK). The washing buffer was left in the wells for 10 minutes following the last wash ...
-
bioRxiv - Molecular Biology 2024Quote: ... Each PCR included a negative control using Milli-Q water (Merck; Rahway, New Jersey, United States) instead of template DNA ...
-
bioRxiv - Microbiology 2023Quote: ... The membrane was washed 3 times in TBS before being probed with protein A-peroxidase (Merck, 1:50000 in 10% Skimmed Milk in TBS). The membrane was incubated with 1x LumiGLO® / 1x Peroxidase (CellSignal ...
-
bioRxiv - Immunology 2023Quote: ... PS were washed three times with milliQ H2O over a 100kDa (Spn PS) or 30kDa (GBS PS) Amicon spin filter (Merck, UFC510024 and UFC503024, respectively) centrifuging for 5 minutes at 12,000xg to remove free biotin ...
-
bioRxiv - Cancer Biology 2020Quote: ... the region surrounding the gRNA target sites were amplified by PCR with KOD Hot Start Polymerase (Merck) according to manufacturer’s instructions with the following primer pairs ...
-
bioRxiv - Microbiology 2020Quote: ... the SAG1 promoter and the GFP-coding fragment was amplified by PCR using the KOD polymerase (Merck) and the ML2477/ML2664 primers that included regions for integration by double homologous recombination ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Gene insertion was verified by PCR using the primer pairs pETUpstream/DuetDOWN or DuetUP2/T7 Terminator (Merck) with Enc or mSOG-containing plasmids as template DNA ...
-
bioRxiv - Cell Biology 2019Quote: MTT cell growth assay kit (Merck) was additionally employed to quantify cell viability upon LecB treatment ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell counting kit 8 (Merck, 96992) was applied for 2.5 h as recommended by the manufacturer.
-
bioRxiv - Molecular Biology 2020Quote: ... antibodies were added to each aliquot (equivalent to 100 ml of cell culture): 6μl anti- H3K56ac for the mid-S time point (Merck-Millipore, 07-677-IS (lot# 266732) or 10 μl anti- H3K56ac for the early-S time point (Active Motif ...
-
bioRxiv - Neuroscience 2022Quote: ... slices were washed two times with 1X Phosphate Buffer (30 mM Na2HPO4·12H2O [Merck, 10039-32-4]; 33 mM NaH2PO4 ·2H2O [Merck, 13472-35-0]; pH 7.4) and were dried on Superfrost (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2958 bp) was purified using commercial DNA purification kits (GenElute™ HP Plasmid Miniprep kit, Merck, #NA0160), according to standard procedures ...
-
bioRxiv - Molecular Biology 2019Quote: ... an EcoRI restriction site was removed by performing a PCR on AT1.03 and AT1.03R122KR126K pDRF-GW using KOD polymerase (Merck-Millipore ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products of control and sort2 were concentrated by using Amicon Ultra-0.5 10K (UFC501096, Merck Millipore), and analyzed by pair-end sequencing using NovaSeq 6000 system (Illumina) ...
-
bioRxiv - Cell Biology 2020Quote: Cellular Senescence Assay kit (Merck Millipore: KAA002) was used to detect senescent AML12 by SA β-Gal staining as per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... with a customized Milliplex kit (Merck Millipore).
-
bioRxiv - Molecular Biology 2022Quote: ... and GenElute™ Plasmid Miniprep Kit (Merck), respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... we used Sigma-Aldrich kit from Merck-Sigma ...
-
bioRxiv - Immunology 2023Quote: ... using Mouse Kapa Genotyping kit (Merck-Millipore), primers (500 nM ...
-
bioRxiv - Microbiology 2023Quote: ... Nutrient specific Spectroquant kit (Merck Millipore, US) was used and the concentration was determined spectrophotometrically using a 96-well plate with a microplate reader (FilterMax F5 ...
-
bioRxiv - Molecular Biology 2024Quote: Magna MeRIPTM m6A Kit (17-10499, Merck) was used to enable identification and transcriptome-wide profiling of m6A ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 μl MTT assay kit reagent (Merck) was then added to each well ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product was digested with restriction enzymes and then ligated into pET-17b (Merck Millipore, Burlington, MA, USA) to construct the expression vector pStSOR ...
-
bioRxiv - Microbiology 2022Quote: ... hawaiiensis NRRL 15010 were obtained by ligating PCR-amplified gene sequences with linearized pET11a or pET22b vectors (Merck-Novagen), respectively ...
-
bioRxiv - Immunology 2022Quote: ... The catalytically-inactive SPP D219A mutant was created using overlap-extension PCR (25) with KOD Hot Start Polymerase (Merck) and appropriate primers ...
-
bioRxiv - Microbiology 2024Quote: ... The resulting PCR product was digested with XhoI and NcoI and introduced into the pET-28a vector (Merck Millipore). The ModA E165A ...
-
bioRxiv - Cell Biology 2019Quote: Multiplex analysis based on the xMAP Luminex technology was performed with the use of a kit for MILLIPLEX MAP Porcine Cytokine/Chemokine (magnetic) kit # PCYTMG-23K-13PX (Merck), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: Chromatin was isolated from 20 million cells using the Magna ChIP A/G Kit (One-day chromatin Immunoprecipitation Kits, Merck) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... These samples were stored in the dark and analyzed colorimetrically using a commercial kit (Spectroquant Sulfide kit, Merck, Schaffhausen, Switzerland). Total particulate nitrogen and carbon were determined by filtration of 100 to 220 mL lake water on pre-combusted (400°C ...
-
bioRxiv - Cell Biology 2021Quote: ... CDC50.3 and CDC50.4 were generated using a PCR fragment encoding the mAID–HA and the HXGPRT cassette produced using the KOD DNA polymerase (Novagen, Merck) with the vector pTUB1:YFP-mAID-3HA as template and the primers indicated in Table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... aeruginosa PAO1 served as a template for the amplification of the genes of interest via PCR using the KOD Xtreme polymerase (Novagen/Merck) and cloning primers containing the restriction sites (Eurofins Genomics) ...
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biochemistry 2020Quote: ... Cell debris was removed by centrifugation at 15k g for 1 min and 1 µl of the supernatant was used as template DNA for 25 µl PCR reaction (KOD HotStart, Merck) with primers NbLib-fwd-i (CAGCTGCAGGAAAGCGGCGG ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product was cloned using the hot fusion method (Fu et al., 2014) in pET30a+ vector (Merck, Molsheim France) pre-digested with EcoRI and BglII in order to fusion AgLTP24 with a N-terminal 6XHis flag ...