Labshake search
Citations for Merck :
151 - 200 of 712 citations for hsa mir 32 Real Time RT PCR Detection and U6 Calibration Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Chemiluminescence detection was performed by using the ECL™ Prime Western Blotting System (Cytiva, Merck) and acquired by ChemiDoc Imaging System (Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: ... Detection was performed using an Immobilon® Forte Western membrane substrate (Merck KGA, Darmstadt, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... Samples were separated on a LiChrospher 60 RP-select Hibar RT 5 μm column (Merck) at 18 °C using a gradient of two solvents (0.25 % acetic acid (pH 4 ...
-
bioRxiv - Microbiology 2021Quote: ... After each PCR step the amplified regions were separated on agarose gel and purified using Illustra GFX™ PCR DNA and Gel Band Purification Kit (Merck KGaA).
-
bioRxiv - Immunology 2021Quote: ... After each PCR step the amplified regions were separated on agarose gel and purified using Illustra GFX™ PCR DNA and Gel Band Purification Kit (Merck KGaA). The last oePCR step was performed to amplify the complete SARS-CoV-2S D19 sequence using primers carrying 15bp long 5’ overhangs homologous to the vector backbone ...
-
bioRxiv - Bioengineering 2019Quote: ... The NPs were washed three times in ethanol (99 % absolute, Merck) and three times in deionized water ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were washed three times with 1X PBS (Merck, D8537) to remove excess mucus ...
-
bioRxiv - Neuroscience 2022Quote: ... The animals used in our experiments were genotyped for expression of the transgene by quantitative PCR (qPCR) using the KAPA Mouse genotyping kit (Merck, Cat# MGKITKB-KK7301), with primer sequence (5’-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... for 30min at RT and then incubated with either anti-pHH3 (Merck, #06-570, 1:500) or anti-Ascl1 (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... solution for 30 min at RT and washed for 20min in a 10% formamide (Merck, #F9037), 2X SSC (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... PCR products were cleaned up using the illustra™ ExoProStar™ enzymatic PCR and sequence reaction clean kit according to the manufacturer’s instructions (Merck KGaA, Darmstadt, Germany). Cycle sequencing was performed using the BigDye™ Terminator v3.1 Cycle Sequencing kit and products were purified with the BigDye XTerminator™ purification kit (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and subsequently washed 4 times in Quencher solution (5 mM Trolox (Merck), 10 mM Na-Ascorbate (Merck)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then three times with 100 mM ammonium acetate (Merck, cat. # 1.01116.1000). Embryos were deposited in single spots on a microscope slide and desiccated for one hour in a vacuum chamber ...
-
bioRxiv - Molecular Biology 2023Quote: ... Buffers were filtered two times (0.22 μm pore size filter units, Merck) and degassed for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were washed two times in 50 % formamide (Emsure, ref 1.09684.1000, Merck), 5x saline sodium citrate (SSC ...
-
bioRxiv - Systems Biology 2020Quote: ... Nitrite concentrations in the effluent were always below detection limit (nitrite test strips MQuant, Merck, Darmstadt, Germany). Anoxic conditions were maintained via continuous sparging with Ar/CO2 (95%/5% v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... and revelation was performed using the ECL detection system according to the manufacturer’s instructions (Merck Millipore, WBKLS0500). Scanning for quantification of protein levels was monitored using ImageJ software ...
-
bioRxiv - Biochemistry 2024Quote: ... Final detection was carried out using chemiluminescence HRP substrates (Immobilon Western Chemiluminescent HRP Substrate; WPKLS0500; Merck Millipore) and imaged using ChemiDoc XRS+ (Bio-Rad).
-
bioRxiv - Immunology 2019Quote: ... PCR was performed using KOD polymerase (Merck). Samples were pooled across sub-amplicons and prepared for sequencing using NebNext Ultra II (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and GGCTGTTTAATAGGGGCTGAAC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (CAACTTACTCCTACTTGGCGT and XXXXTGCGTTGATACCACTGCTTT ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were incubated for 1h30min at RT with primary antibodies Centrin-1(20H5) (1/1000, Merck 04-1424) and CP110 (1/250 ...
-
bioRxiv - Neuroscience 2023Quote: ... cryosections were incubated at RT for 1 h in darkness with the secondary antibody and Hoechst 33258 (Merck) as a nuclear counterstain ...
-
bioRxiv - Microbiology 2022Quote: ... was diluted 100 times in 0.22 μm-filtered DMSO (IC Millex, Merck, USA) and Propidium Iodide (20 mM in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Cell Biology 2022Quote: ... washed three times with PBS and permeabilized with 0.1% Triton X-100 (Merck) in PBS for 5 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 40 times by centrifugal filtration (3K Amicon Ultra, Merck Millipore, 14’000g, 4°C) and buffer was exchanged to 4M Guanidine hydrochloride in 50mM HEPES (pH 7.8) ...
-
bioRxiv - Developmental Biology 2019Quote: ... washed again 3 times 15 min and developed using Millipore Crescendo ECL (Merck). For western blot quantification ...
-
bioRxiv - Developmental Biology 2021Quote: ... washed 3 times in PBS with 1x cOmplete Protease Inhibitor Cocktail (Merck, 11697498001).
-
bioRxiv - Immunology 2020Quote: ... by filtrating four times over 100 kDa cut-off cellulose centrifugal filter (Merck).
-
bioRxiv - Microbiology 2023Quote: ... Cells were washed four times with PBS and lysed with 2% saponin (Merck) for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... PCR grade water (Lichrosolv®; Merck, Darmstadt, Germany). The qPCR was performed in triplicates using the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... or Power SYBR Green PCR Master Mix (Merck). For all groups ...
-
bioRxiv - Genomics 2023Quote: ... PCR reactions were conducted using KAPA Taq (Merck) according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection of newly synthesized proteins was carried out by an anti-puromycin antibody (clone 12D10, mouse-monoclonal, MABE343; Merck), an anti-HuD antibody (ab96474 ...
-
bioRxiv - Neuroscience 2022Quote: ... 50 μL/well of detection antibody (anti-FLAG-D2) diluted in Erenna Assay buffer (catalog #02-0474-00; Merck) at the final concentration of 1 μL/mL were added to the assay plate and incubated for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... The in situ proximity ligation assay (PLA) in combination with immunofluorescence microscopy was performed using the Duolink Detection (Merck) or the NaveniFlex (Navinci diagnostics ...
-
bioRxiv - Cancer Biology 2023Quote: ... Detection by enhanced chemiluminescence was performed using the Immobilon Forte HRP Western substrate (ref WBLUF0500, Merck Millipore, Darmstadt, Germany) or SuperSignal West Femto Maximum Sensitivity Substrate (ref 34096 ...
-
bioRxiv - Neuroscience 2023Quote: Primary antibodies used for the detection of the autophagic mechanisms by immunoblot were anti-LC3B antibody (Merck Group, L7543) and anti-SQSTM1/p62 (Merck Group ...
-
bioRxiv - Cell Biology 2023Quote: ... Detection by enhanced chemiluminescence was performed using the Immobilon Forte HRP Western substrate (ref WBLUF0500, Merck Millipore, Darmstadt, Germany) or SuperSignal West Femto Maximum Sensitivity Substrate (ref 34096 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were incubated for 1.5 hours at RT with an antibody against Hp1α (Merck Millipore, MAB3584, 1:500 dilution) and RNA Polymerase II (Santa Cruz ...
-
bioRxiv - Neuroscience 2019Quote: ... Slides were air dried overnight in the dark at RT and cover-slipped using entellan-toluene solution (Merck Chemicals) the following day.
-
bioRxiv - Microbiology 2021Quote: Cells grown on glass coverslips were fixed in 4% PFA for 30 min at RT and permeabilized with 0.2% Triton X-100 (Sigma/Merck) in PBS for 10 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... the nuclei were visualized with Hoechst 33258 (Merck, B2883, 2 µg/ml in H2O at RT for 5 min).
-
bioRxiv - Neuroscience 2023Quote: ... 1c and Fig.3 were first fixed with 4% PFA solution for 30 minutes at RT and quenched with 0.1 M glycine (Merck) solution in PBS for 15 minutes at RT ...
-
bioRxiv - Bioengineering 2023Quote: ... for 20 min at room temperature (RT) and permeabilised overnight at 4 °C in 0.5% Triton X-100 (Merck) solution in PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... specimens were post-fixed for 2 h at RT in 1% osmium tetroxide in 0.05 M cacodylate buffer pH 7.4 (Merck, Germany) and dehydrated stepwise in a graded ethanol series followed by 100% acetone ...
-
bioRxiv - Neuroscience 2024Quote: ... and then blocked for 1 h at RT with 0.2% Triton-X in PBS + 1% normal goat serum (NGS, Merck). Antibodies used and their concentration is found in Supplementary Table 4 ...
-
bioRxiv - Cell Biology 2024Quote: ... The immunostainings were performed at RT using tris-buffered saline (TBS) containing 1.6% (v/v) fish gelatine (G7765, Merck) as the basal buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were clarified by centrifugation (10,000 x g, 30 min, RT) and incubated for 1 hour with Ni-NTA His bind resin (Merck) rolling at RT ...
-
bioRxiv - Cancer Biology 2020Quote: ... slides were washed with deionized water three times and counterstained with Mayer’s hematoxylin (Merck). Slides were then rinsed with deionized water for 5 minutes and mounted with a coverslip using Aquatex mounting medium ...