Labshake search
Citations for Merck :
251 - 300 of 1010 citations for Recombinant Human Lectin Galactoside Binding Soluble 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... the bacterial suspension and human serum (Merck, Darmstadt, Germany) were mixed in a 1:1 ratio (100 µL each) ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-human nuclei (HuNu; 1:100; MAB4383, Merck Millipore), and anti-E-cadherin-1 (ECAD ...
-
bioRxiv - Cell Biology 2024Quote: ... 50nM Mission esiRNA against human PTGER2 or PTGER4 (Merck). 50nM non-targeting Silencer™ Negative Control #1 siRNA (Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Cell Biology 2020Quote: Recombinant protein expression was performed using Eschericia coli strain Rosetta™ 2 (DE3) (Novagen) (Merck Cat. No 71403). Protein expression was always performed using freshly transformed chemically competent E ...
-
bioRxiv - Immunology 2019Quote: ... Cells were interferon stimulated by the addition of 100 IU/ml recombinant interferon-β (IFN-β; Merck, 407318) to the growth media for 24 h ...
-
bioRxiv - Zoology 2020Quote: ... recombinant RhATG5 and RhATG5191-199Δ were affinity-purified using Ni-NTA His•Bind Resin (Merck-Millipore, Darmstadt, Germany). Recombinant RhATG5 and RhATG5191-199Δ were then incubated with 10µg μ-calpain (Merck ...
-
bioRxiv - Biochemistry 2021Quote: RNA immunoprecipitation (RIP) assays were conducted using the EZ-Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Merck Chemicals (Shanghai Co., Ltd). The anti-YTHDC1 antibody for RIP was purchased from Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2022Quote: Hippocampal tissues from P40 WT mice were collected and lysed with IP lysis buffer in EZ-Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Merck-Millipore). YTHDF2 (Proteintech ...
-
bioRxiv - Neuroscience 2019Quote: Plasma levels of adiponectin and leptin were measured using commercially available kits (Human Leptin Enzyme Immunoassay, Merck, Cat. #A05174 and Human Adiponectin ELISA, Merck, Cat. # EZHADP-61K). The minimum detectable dose of leptin was 7.8 pg/mL and that of adiponectin was 0.891 μg/mL.
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Pathology 2022Quote: ... The elution fraction containing His6-PhoP was dialyzed in Binding Buffer to remove the high concentration of imidazole and concentrated using an ultrafilter (Merck KGaA, Darmstadt, Germany). SDS-PAGE and Western blot with an anti-His tag antibody was used to confirm the purified protein (ABclonal ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were seeded in culture dishes and the specific pharmacological inhibitors radicicol (inhibitor of ATP-binding site of Hsp90, Sigma-Aldrich, Merck, Darmstadt, Germany), cyclosporine A (inhibitor of Cyp activity ...
-
bioRxiv - Genomics 2022Quote: ... followed by quenching with final 1 x Glycine solution for 5 min at RT utilizing the Magna Nuclear RIP (Cross-Linked) Nuclear RNA-Binding Protein Immunoprecipitation Kit (Merck millipore, 17-10520). Cross-linked cells were then centrifuged at 800 x g at 4°C and washed three times with ice cold DPBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... 250 ng of pTOPflash (wt-TCF) or pFOPflash (mutated-TCF binding site, negative control) reporter plasmids (TOPflash luciferase reporter assay, Merck Millipore, Darmstadt, Germany) were transfected with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Plant Biology 2024Quote: ... and then clarified via passing through Millex® -GP Fast Flow & Low Binding Millipore Express® PES Membrane 0.22 µm syringe filter unit (SLGP033RS, Merck Millipore, USA).
-
bioRxiv - Immunology 2021Quote: ... Human pancreatic beta cell line 1.4E7 was purchased from Merck and cultured in RPMI-1640 medium (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... Part B was made of 10U/mL human thrombin (Merck) in DMEM/F12 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and purified human C3a was purchased from Merck (Perth, Australia). Recombinant human C5a (rhC5a ...
-
bioRxiv - Immunology 2020Quote: ... FITC conjugated goat anti-human IgG Fc was from Merck, Dorset ...
-
bioRxiv - Microbiology 2023Quote: ... sensitivity assays against human serum (Merck Millipore, Burlington, MA, USA), colistin (Sigma-Aldrich ...
-
bioRxiv - Genomics 2023Quote: ... After incubation with FcBlock (PBS + 12% human serum AB (Merck)) for 10 min at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The human cardiomyocyte cell line AC16 was purchased from Merck Millipore (Burlington ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... and HRP-conjugated goat anti-human IgG (AP309P, Merck KGaA). Protein detection was done with enhanced chemiluminescence (ECL ...
-
bioRxiv - Cell Biology 2024Quote: ... coated with 50 µg/ml human serum fibronectin (Merck, Germany). Imaging was performed on a Nikon Widefield Ti2 equipped with a sCMOS ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant GST-mm-FMN2-eFSI (GST-FMN2-eFSI) proteins were expressed in Escherichia coli Rosetta bacterial cells (Merck Millipore). Bacteria were cultured in LB medium (100 mg/l ampicillin ...
-
bioRxiv - Biophysics 2020Quote: ... beads were removed and recombinant dynein was concentrated in a 100 KDa cut-off filter (Amicon Ultracel, Merck-Millipore) to a final volume of 500 μL ...
-
bioRxiv - Microbiology 2023Quote: ... were incubated for 2 h at room temperature with the respective recombinant glycosyltransferase enzymes (6.3 µg/ mL) and UDP-GlcNAc (2 mM, Merck) in glycosylation buffer (15 mM HEPES ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.