Labshake search
Citations for Merck :
401 - 450 of 1218 citations for Recombinant Human 5' Nucleotidase Ecto CD73 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 % heat-inactivated horse serum (Merck), EGF (20 ng mL−1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). At least 3 independent experiments with at least 2 independent littermate MEF clones of each genotype and each sex were performed to measure DNA damage responses ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). Four independent experiments were performed.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml holo-transferrin (Merck, cat. #T0665), 5 ng/ml EGF (Merck ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Immunology 2019Quote: ... WEHI-345 (0, 5 or 10 μM) 23 or Z-YVAD-fmk (0, 1, 5 and 10 μM; 21874; Merck, Australia) for 1 hr prior to stimulation with H ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...
-
bioRxiv - Molecular Biology 2019Quote: To evaluate microscopic features of the captured cells such as morphological types and possible alterations we then used another collection membrane directly stained with hematoxylin and eosin after fixation for 10 min in a fixation solution (100 mL of 70% ethanol, 5 mL of glacial acetic acid and 5 mL of 37% formaldehyde solution – all solutions are from Merck Millipore). Samples were hydrated with distilled water for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2024Quote: ... the MFI-value was converted to ng/mL by interpolation from a 5-parameter logistic (5-PL) curve of reference standard using the MILLIPLEX® Analyst 5.1 software (The Life Science/Merck KGaA).
-
bioRxiv - Neuroscience 2021Quote: ... Anti-human Aβ mouse monoclonal antibody (clone W0-2; Merck Chemicals GmbH, Darmstadt, Germany) and rabbit anti-β-actin monoclonal antibody (clone 13E5 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and seeding on 16.7 µg/ml human plasma fibronectin-coated plates (Merck Millipore, FC010). After 48h ...
-
bioRxiv - Bioengineering 2021Quote: ... Human plasminogen-depleted fibrinogen was utilized for hydrogel preparation when stated (Merck, Darmstadt, Germany). Aprotinin was purchased from R&D Systems (Minneapolis ...
-
bioRxiv - Zoology 2021Quote: C-peptide and glucocorticoid levels were determined using a radioimmunoassay (Human C-Peptide, Merck Millipore ...
-
bioRxiv - Cell Biology 2022Quote: ... Mission siRNA for human Pacsin 2 siRNA (SASI_Hs01_0021-5538, SASI_Hs01_0021-5539 and SASI_Hs01_0021-5540, Merck) or MISSION siRNA Universal Negative Control #1 (SIC-001 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Calibration curve samples were generated by diluting the International Standard with human plasma (Merck) to create a standard curve ranging from 955 000 IU/mL to 95.5 IU/mL with three technical replicates of each concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human kindlin2 (mouse monoclonal, 3A3, Merck, MAB2617; WB 1:1000, IF 1:200), anti-mouse kindlin2 (rabbit polyclonal ...
-
bioRxiv - Cell Biology 2024Quote: Human embryonic kidney (HEK293) cells were cultured in Dulbeccoʹs Modified Eagleʹs Medium (DMEM, Merck) containing 10% Fetal Calf Serum and 1% Antibiotic Antimycotic Solution (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: ... fillet dissections of L3 larvae or pharate adults were performed in modified HL3 solution ([HL3-EGTA] 70 mM NaCl, 5 mM KCl, 10 mM NaHCO3, 20 mM MgCl2, 5 mM trehalose (Merck KGaA, 108216), 115 mM sucrose (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by embedding in 5 % low melting agarose (Merck). Gelatinated blocks were washed in 0.1 M Soerensen’s phosphate buffer (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5% (v/v) Donkey serum (Merck Millipore, S30-100ML) for more than 1h at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C and samples were eluted with 5 mM H2SO4 in water at a 0.3 ml/min flow rate.
-
bioRxiv - Genetics 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 80 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mg/mL Triton X-100 (Merck, X100). Solubilisation was carried at 4 °C for 20 min with mild agitation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ cyclic mono-phosphate (8-Br-cAMP, Merck B5386) and 1 μM medroxyprogesterone acetate (MPA ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% CO2 in MEM (Merck Life science UK limited) with 10% FBS ...
-
bioRxiv - Microbiology 2019Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C and samples were eluted with 5 mM H2SO4 in water at a 0.3 ml/min flow rate.
-
Efficient breeding of industrial brewing yeast strains using CRISPR/Cas9-aided mating-type switchingbioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C ...
-
bioRxiv - Biophysics 2021Quote: ... Gefitinib (Y0001813, Merck; used at 5 μM final concentration), SCH772984 (S7101 ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-incubated for 30 minutes in 5% BSA (Merck) in PBS containing 0.05% Tween-20 (PBST) ...
-
bioRxiv - Systems Biology 2020Quote: ... blocked with 5% bovine serum albumin (BSA, Merck, #821006) and 0.3% Triton X-100 (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... and 5% normal donkey serum (Merck Millipore S30-100mL). After that ...
-
bioRxiv - Pathology 2022Quote: ... per mouse) and for 5 minutes with liberase (MERCK, cat ...
-
bioRxiv - Systems Biology 2022Quote: ... or 5 mM TCEP (Merck Sigma, Cat. No. C4706) and incubated for 1 hour or 30 min at 37°C or 56°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μm SeQuant ZIC-pHILIC column (Merck, VIC, Australia), with a 20 × 2.1 mm SeQuant ZIC-pHILIC guard column was used ...
-
bioRxiv - Microbiology 2019Quote: ... and 5 g/L sodium chloride (Merck, S3014-1kg). Following overnight growth ...
-
bioRxiv - Immunology 2019Quote: ... pre-coated with fibronectin (5 μg/ml, Merck Millipore) for evaluation of NDTRs ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μm and 0.22 μm filters (142 mm, Merck). Filters with 5 μm and 0.22 μm pore size were stored immediately on dry ice on board and at –80°C in the laboratory until further processing ...
-
bioRxiv - Molecular Biology 2021Quote: ... or with 5 μg/ml α-amanitin (Merck, A2263) as indicated in the text.
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were stained with 5 μg/ml Hoechst (Merck). Images were taken at 630-fold magnification on a Leica DM 5000B microscope with a Leica DFC 300 FX camera ...
-
bioRxiv - Molecular Biology 2022Quote: ... proteasomal degradation inhibitor: MG132 (5 – 50 µM, Merck KgaA); cathepsin inhibitors ...
-
bioRxiv - Biophysics 2022Quote: ... and 5 mg/mL α-casein (Merck, Darmstadt, Germany) (7 ...
-
bioRxiv - Microbiology 2022Quote: ... Nuclei were stained with 5 µg/ml Hoechst (Merck) in PBS for 30 min.
-
bioRxiv - Biophysics 2022Quote: ... membrane-impermeant Cy®5 Mono NHS Ester (Merck / Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 µg/mL Heparin (MERCK, Cat. no. H3149-25KU), 1X N2 Supplement ...
-
bioRxiv - Microbiology 2022Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at ambient temperature 55 °C and analyzed samples were eluted with 5 mM H2SO4 in water at flow rate of 0.3 mL/min.
-
bioRxiv - Cancer Biology 2022Quote: ... Blocking was completed via incubation with 5% BSA (Merck) solution for 1 hour followed by overnight incubation at 4°C with 1:100 dilutions of DNA labelled anti-P2Y2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and blocked with 5% goat sera (Merck, Darmstadt, Germany) in PBST with for one hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... obtained from filtration through a 5-μm filter (Merck), and then to drain spent medium into the waste bottle ...