Labshake search
Citations for Merck :
1 - 50 of 1768 citations for Rat Protein L Isoaspartate PCMT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ELISA was performed to detect serum GH (rat/mouse growth hormone ELISA kit, Merck KGaA, Dermstadt, Germany), IGF-1 (mouse/rat IGF-1 ELISA kit ...
-
bioRxiv - Pathology 2024Quote: ... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
bioRxiv - Physiology 2020Quote: Insulin concentrations were measured by ELISA (EZRMI-13K Rat/Mouse insulin ELISA, Merck Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and insulin levels were estimated using a total rat insulin ELISA kit (Merck Millipore, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: Serum insulin was determined using a rat/mouse insulin ELISA kit (Millipore, Billerica, Merck KGaA, USA) as instructed ...
-
bioRxiv - Neuroscience 2021Quote: ... The concentrations of Aβ40 and Aβ42 were determined in brain lysates using the ELISA kits according to the manufacturer’s instructions (human Aβ40 and Aβ42 brain ELISA, Merck).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Respective ELISA kits (insulin, leptin, IL-6 – MilliPlex Map Mouse Adipokine kit, Merck, Germany ...
-
bioRxiv - Microbiology 2021Quote: ... GLP-1 (GLP-1 total ELISA kit, Merck, Darmstadt, Germany) and biochemical parameters including ALT ...
-
bioRxiv - Neuroscience 2021Quote: ... and high-sensitivity GLP1 Active ELISA kit were acquired from Merck Millipore (Billerica ...
-
bioRxiv - Microbiology 2021Quote: ... the serum levels of total GLP-1 (ELISA kit, Merck, Darmstadt, Germany) and IAA (ELISA kit ...
-
bioRxiv - Developmental Biology 2022Quote: ELISA kits were used for measurements Growth Hormone (Merck-SIGMA EZRMGH-45K) according to manufacturers’ instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Plasma leptin and insulin levels were measured by murine ELISA kits (Merck Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... We measured Leptin levels using mouse leptin ELISA kit (Merck Life Sciences) according to manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2022Quote: ... The L-lactate concentration was measured using a L-lactate Assay Kit (Sigma-Aldrich MAK329, Merck, France). 20 μL of pre-treated and 0.4 μm filtered feces samples were used for each reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... and for miniTurbo–TAF protein expression using a rat anti-HA-HRP antibody (3F10, Merck, 12013819001). The protein concentration was determined with Protein Assay Dye Reagent Concentrate (Biorad ...
-
bioRxiv - Bioengineering 2022Quote: ... Protein concentrations were determined with the BCA protein assay kit (Novagen, Merck KGaA), and protein homogeneity was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Cancer Biology 2021Quote: Intracellular protein was extracted from cells using the NucBuster Protein Extraction Kit (Merck) and quantified using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentration was estimated using BCA protein assay kit (Merck, 71285-3, Germany).
-
bioRxiv - Neuroscience 2021Quote: ... protein concentration was quantified using a Sigma-Aldrich BCA protein assay kit (Merck). Subsequently ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Nunc MaxiSorp ELISA plates (M9410, Merck), 10% BSA ELISA reagent diluent/blocking solution concentrate (DY995 ...
-
bioRxiv - Microbiology 2024Quote: ... and phytohemagglutinin-L (PHA-L; Merck) at 2μg/ml for 72h ...
-
bioRxiv - Physiology 2020Quote: ... Total proteins from the supernatant were quantified using a Bradford Protein Assay Kit (Merck) and subjected to electrophoresis on 15% SDS–PAGE gels ...
-
bioRxiv - Physiology 2022Quote: ... Protein carbonylation was assessed with an Oxyblot protein oxidation detection kit (#S7150, Merck Millipore) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... RIPA and FA fractions was assessed using the Human Aβ1-42 enzyme-linked immunosorbent assay (ELISA) Kit (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Cytokine and chemokine levels were measured with a commercial rat cytokine/chemokine magnetic bead panel 96-well plate assay kit (Milliplex MAP kit, Merck Millipore), which detects 5 cytokines and chemokines including IP-10/CXCL10 ...
-
bioRxiv - Physiology 2024Quote: ... and quantified by ELISA (Merck, EZRMI-13K). Diurnal sampling of blood for glucocorticoid profiling was performed (0800h and 2000h ...
-
bioRxiv - Molecular Biology 2022Quote: Millipore Compartment Protein Extraction Kit (Merck-Millipore, Cat. #2145) was used to deplete cytosolic ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-HA (rat; Merck; 11867423001), anti-exportin-1 (mouse ...
-
bioRxiv - Immunology 2021Quote: ... A rat IgG1 antibody (Merck) was used as the isotype-matched control ...
-
bioRxiv - Molecular Biology 2024Quote: ... Rat monoclonal (1:250; Merck) and incubated in 4°C for 5 nights ...
-
bioRxiv - Physiology 2022Quote: ... To detect total protein carbonylation by immunoblot we used the OxyBlot Protein Oxidation Detection kit (Merck) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates were measured for protein concentration using a Non-Interfering protein Assay kit (cat#488250, Merck Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... apically coated with 0,1 % collagen from rat tail (collagen type I, rat tail; Merck, Germany) at a density of 1.5 × 105 cells / well and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... rat anti CRB3 1E6 (MABT1366 Merck), mouse anti-paxillin (BD transduction 612405) ...
-
bioRxiv - Cell Biology 2021Quote: ... The supernatants were then used to quantify the level of adiponectin using Mouse Adiponectin ELISA kit (Merck Millipore #EZMADP-6 K) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2024Quote: ... L-kynurenine (Merck), pyrazinamide (Merck ...
-
bioRxiv - Cell Biology 2023Quote: Protein carbonyl formation by oxidative reactions was assessed with the OxyBlot Protein Oxidation Detection Kit (S7150, Merck Millipore), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... 4mg/L tobramycin (TOB) or 16mg/L LL-37 (Merck, UK), to a final volume of 200μL ...
-
Critical contribution of mitochondria in the development of cardiomyopathy linked to desmin mutationbioRxiv - Pathology 2023Quote: ... Soluble proteins were then dosed using the Bicinchoninic Acid Kit (Merck) and diluted in Laemmli protein sample buffer ...
-
bioRxiv - Immunology 2022Quote: ... The protein concentration of ES antigen was estimated using protein estimation kit by Bradford method (Merck GeNei™, Bangalore).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The eluted corona proteins from nanoparticles were first precipitated by using the ProteoExtract® Protein Precipitation Kit (Merck, Germany) as described in the manufacturer protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... rat anti-tyrosinated tubulin (YL1/2, Merck), mouse anti-acetylated tubulin (T6793 ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-CRB3A (1/50 MABT1366, Merck). Secondary antibodies were incubated 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... rat monoclonal anti CTIP2/BCL11B (MABE1045, Merck), rabbit anti-PSD95 (ab269863 ...
-
bioRxiv - Microbiology 2023Quote: ... rat anti-human β1 IgG1 (AIIB2; Merck), mouse anti-human β1 IgG1 (Lia1/2 ...
-
bioRxiv - Physiology 2024Quote: ... CD45: 1:800 rat monoclonal (all Merck); CD31 ...
-
bioRxiv - Cell Biology 2021Quote: ... The main culture (TB medium: 0.9 L, 1.2 g/L NH4SO4 (Merck), 0.041 g/L KH2PO4 (Merck) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 20 g/L peptone (Difco) and 20 g/L glucose (Merck Millipore). Synthetic complete medium without uracil (SC-URA) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Pramlintide was quantified by ELISA (Merck Millipore, cat # EZHA-52) according to manufacturer instructions ...