Labshake search
Citations for Merck :
1 - 50 of 179 citations for Rat BRSK1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... MISSION® shRNA lentiviral plasmids (Merck) were used for knockdown of LOX (shLOX1 – TRCN0000045991 ...
-
bioRxiv - Pathology 2024Quote: ... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
bioRxiv - Physiology 2020Quote: ... MISSION shRNA (TRCN0000280118) or control pLKO plasmid were purchased from Merck and co-transfected with psPAX2 (a gift from Didier Trono ...
-
α-catenin links integrin adhesions to F-actin to regulate ECM mechanosensing and rigidity-dependencebioRxiv - Cell Biology 2021Quote: Lentiviral KD of α-catenin was performed using the SHCLNG-NM_009818 MISSION® shRNA plasmid (Merck); control cells were generated using the SHC202 -MISSION® TRC2 pLKO.5-puro Non-Mammalian shRNA Control Plasmid (Merck) ...
-
ST6GAL1-mediated heterogeneity in sialic acid levels potentiates invasion of breast cancer epitheliabioRxiv - Cancer Biology 2020Quote: ST6GAL1 gene shRNA clone was obtained from MISSION shRNA library (Sigma Merck, USA). Plasmid containing shRNA or scrambled control was packaged into lenti virus using packaging vectors pMD2.G and psPAX2 (packaging vectors were a kind gift from Dr ...
-
α-catenin links integrin adhesions to F-actin to regulate ECM mechanosensing and rigidity-dependencebioRxiv - Cell Biology 2021Quote: ... control cells were generated using the SHC202 -MISSION® TRC2 pLKO.5-puro Non-Mammalian shRNA Control Plasmid (Merck). After infection ...
-
bioRxiv - Neuroscience 2024Quote: ... For the expression of short hairpin RNA (shRNA) we used lentiviral plasmids pLKO.1-ATF4 for ATF4 (TRCN0000301721) with the target sequence: CGGACAAAGATACCTTCGAGT (#SHCLND, Merck) and for non-targeting controls a pLKO.1-plasmid encoding a scrambled sequence (shNTC) ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1-shGAL-9 (MISSION® shRNA library, Merck), psPAX2 and pMD2.G (packaging vectors were a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2020Quote: ... For RNA interference lentiviral particles were produced using following short hairpin RNA (shRNA) constructs purchased from the Mission TRC shRNA Library (Merck, Darmstadt, Germany): control shRNA (SHC002) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Expression of shRNA was induced with 0.1μg/ml doxycycline (Merck). Cells were counted every other day and the cell concentration was adjusted to 0.4×106/ml.
-
bioRxiv - Cancer Biology 2024Quote: ... we used the MISSION® Lentiviral shRNA (Sigma Aldrich/Merck, SHCLNG – clones ...
-
bioRxiv - Microbiology 2023Quote: ... PLKO.1 TRC cloning vectors expressing shRNA sequences were purchased from Merck or Dharmacon ...
-
bioRxiv - Immunology 2023Quote: ... Cells infected in two independent attempts with non-mammalian shRNA transduction particles (Merck) served as controls ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-HA (rat; Merck; 11867423001), anti-exportin-1 (mouse ...
-
bioRxiv - Immunology 2021Quote: ... A rat IgG1 antibody (Merck) was used as the isotype-matched control ...
-
bioRxiv - Molecular Biology 2024Quote: ... Rat monoclonal (1:250; Merck) and incubated in 4°C for 5 nights ...
-
bioRxiv - Cell Biology 2023Quote: ... apically coated with 0,1 % collagen from rat tail (collagen type I, rat tail; Merck, Germany) at a density of 1.5 × 105 cells / well and incubated at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... rat anti CRB3 1E6 (MABT1366 Merck), mouse anti-paxillin (BD transduction 612405) ...
-
bioRxiv - Cell Biology 2022Quote: ... rat anti-tyrosinated tubulin (YL1/2, Merck), mouse anti-acetylated tubulin (T6793 ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-CRB3A (1/50 MABT1366, Merck). Secondary antibodies were incubated 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... rat monoclonal anti CTIP2/BCL11B (MABE1045, Merck), rabbit anti-PSD95 (ab269863 ...
-
bioRxiv - Microbiology 2023Quote: ... rat anti-human β1 IgG1 (AIIB2; Merck), mouse anti-human β1 IgG1 (Lia1/2 ...
-
bioRxiv - Physiology 2024Quote: ... CD45: 1:800 rat monoclonal (all Merck); CD31 ...
-
bioRxiv - Developmental Biology 2021Quote: ... TBTX inducible knockdown in the TBXT shRNA sOPTiKD hESC line was achieved using tetracycline hydrochloride (Merck Life Science) at 1μg/ml as described previously (Bertero et al. ...
-
bioRxiv - Immunology 2022Quote: Antibodies: Rat anti-mMLKL 5A6 and rat anti-mRIPK3 1H12 were produced in-house69 (5A6 available from Merck as MABC1634). Mouse anti-actin (A-1978 ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-L1CAM rat monoclonal (1:500, Merck, MAB5272), anti-Neuropilin1 goat polyclonal (1:300 ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-SST rat monoclonal (1:200; Merck, MAB354), anti-L1CAM rat monoclonal (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... rat immunoglobulin (Ig) G (Merck, 2-5μg/ml), U0126 (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... rat anti-HA (clone 3F10, Cat#11867423001, Merck), rabbit anti-HA (Cat#ab9110 ...
-
bioRxiv - Biochemistry 2023Quote: ... HA clone 3F10 (rat monoclonal, Sigma-Aldrich / Merck),) ...
-
bioRxiv - Developmental Biology 2023Quote: ... TBTX inducible knockdown in the TBXT shRNA sOPTiKD hESC line was achieved using Tetracycline (Tet) hydrochloride (Merck Life Science) at 1 μg/ml as described previously (Bertero et al. ...
-
bioRxiv - Immunology 2023Quote: Cells were infected separately with five different lentiviral transduction particles (at MOI = 5) containing five different shRNA species (Merck) specific for the mouse Flot2 gene (NM_008028 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10,000 cells were seeded in 12-well dishes and co-infected the next day with 4EBP1 and 4EBP2 shRNA viruses in medium supplemented with 4 µg/ml polybrene (Merck). Cells were grown until confluency and reseeded into 6-well dishes prior to addition of 1 µg/ml puromycin (InvivoGen ...
-
bioRxiv - Cell Biology 2021Quote: ... and goat anti-rat IgG HRP(1:5000; Merck); and goat anti-mouse IgG HRP (1:5000 ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-MBP (1:300) (#MAB386, Merck-Millipore, Germany). After two washes in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... polyclonal rat anti-dopamine transporter (MAB369, Merck (Sigma-Aldrich); 1:1000).
-
bioRxiv - Neuroscience 2023Quote: ... or rat anti-MBP (1:500, Merck Millipore, MAB386) primary antibodies followed by AlexaFluor546 goat anti-rat (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... rat anti-Substance P (Merck & Co., Inc.; 1:500), rabbit anti-Substance P (ImmunoStar Inc. ...
-
bioRxiv - Cell Biology 2024Quote: ... or rat tail collagen coating solution (122-20; Merck) was added to the cell culture dishes at 1 ml per 10 cm2 surface area and incubated for 45 or 120 min at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... rat monoclonal anti-HA (3F10) from Merck (Darmstadt, Germany), mouse monoclonal anti-myc (9E10 ...
-
bioRxiv - Immunology 2021Quote: Lentiviral plasmids encoding shRNAs targeting GFP (control; SHC005) and MAVS (06: TRCN0000149206; 45: TRCN0000148945) were obtained from the Sigma Mission library (Merck Darmstadt). Lentiviral particles for transduction were generated as follows ...
-
bioRxiv - Molecular Biology 2021Quote: ... rat anti-Ser2 Pol II (AB_11212363, Merck Millipore, 1:5000). Respective secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-Nestin mAB (clone rat-401,1:1000, Merck chemicals MAB353), anti-PDH mAb (E1α ...
-
bioRxiv - Physiology 2019Quote: For Immunobloting: anti-Ly108 (Rat, 3E11, Merck, Kenilworth, NJ, USA), anti-SAP (Rat ...
-
bioRxiv - Microbiology 2022Quote: ... and 15 µg/mL rat tail collagen (Merck, St.Louis, USA) pre-coated cell culture 6-well plate with EBM-2 endothelial media supplemented with 10% FBS and a growth factor bullet kit (Lonza ...
-
bioRxiv - Genomics 2021Quote: ... The cloned shRNAs against the respective EWRS1-ETS fusion oncogenes was induced by addition of 1 µg/ml dox (Merck, Darmstadt, Germany) to the cell culture medium ...
-
bioRxiv - Neuroscience 2019Quote: ... rat anti-mouse VCAM-1 (Merck, cat.# CBL-1300, 1:100), rat anti-mouse ICAM-1 (Abcam ...
-
bioRxiv - Biochemistry 2023Quote: ... HA clone 3F10 (rat monoclonal, conjugated to FITC, Sigma-Aldrich / Merck), GFP (mouse monoclonal ...
-
bioRxiv - Cell Biology 2022Quote: ... shMYO10 #3 and shMYO10 #4 cell lines were generated using lentiviruses particles containing a non-target control shRNA (Merck, Cat Number: SHC016V-1EA) or shRNA targeting human MYO10 respectively (shMYO10 #3 ...