Labshake search
Citations for Merck :
101 - 150 of 1098 citations for Rat Aflatoxin B1 Aldehyde Reductase Member 3 AKR7A3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... 3% sodium nitroprusside (Merck, S0501), 2.5% menadion (Merck ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 µg of the digested RNA was reverse-transcribed as described above and validated by PCR using the KOD Xtreme HotStart Polymerase Kit (#71975-3; Merck, PCR program ...
-
bioRxiv - Immunology 2023Quote: ... rat anti-hRIPK3 1H24 (1:1000; available from Merck-Millipore as MABC1640) were produced in-house ...
-
bioRxiv - Immunology 2023Quote: ... rat anti-hMLKL 10C222 (1:1000; available from Merck-Millipore as MABC1635), rat anti-hMLKL 7G222 (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... rat anti-hMLKL 7G222 (1:1000; available from Merck-Millipore as MABC1636), rat anti-hRIPK3 1H24 (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... rat anti-mMLKL 5A669 (1:1000; available from Merck-Millipore as MABC1634), rat anti-hMLKL 10C222 (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-DIV cultured human spinal motor neurons and C5-C7 ventral horns of adult animals 3 days after surgery were estimated using a Rac1/Cdc42 Activation Assay Kit (#17-441, Merck Millipore). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: RNAs with sequences 5’-AAGGAUGGAUGGAG-3’ (healthy) and 5’-AAGCAUGGAUGGAG-3’ (risk) were synthesised by Merck, resuspended in Ultrapure water ...
-
bioRxiv - Plant Biology 2021Quote: Arabidopsis 14-3-3 isoforms Epsilon and Lambda were expressed using the pGEX-4T1 vector (Merck), as a translational fusion with glutathione-S-transferase (GST ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1x phosphatase inhibitor 3 (Merck). Cell debris was removed by pelleting at 5000g for 10mins ...
-
bioRxiv - Immunology 2021Quote: ... 3-Methyladenine (3MA, 5mM; Merck Millipore) or Anakinra (500ng/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-mGluR2/3 (Merck Millipore), rabbit anti-CRTAC1 (Merck Millipore) ...
-
bioRxiv - Neuroscience 2019Quote: ... 3-octanol (OCT; 1:1000; Merck) and 4-methylcyclohexanol (MCH ...
-
bioRxiv - Neuroscience 2022Quote: ... primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 3% bovine serum albumin (Merck). The azide-alkyne reaction was performed using the Click-iT™ Cell Reaction Buffer Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... nystatin (3 units/ml) (Merck: N1638) and ascorbic acid (500 μM ...
-
bioRxiv - Developmental Biology 2023Quote: ... or 3% Rabbit Serum (R9133, Merck)) and finally applying the conjugated antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (Merck; UK 28718-90-3) was included as a final wash stage ...
-
bioRxiv - Physiology 2024Quote: ... - 3% horse serum (Merck, ref H1270) PBS solution for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 units/ ml nystatin (Merck: N1638) and 20 mM HEPES ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Genomics 2023Quote: ... then immersed in an amino-silane solution (3% vol/vol (3-aminopropyl) triethoxysilane (Merck cat no. 440140), 5% vol/vol acetic acid (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... All ELISAs were developed with 100 µl substrate solution per well containing 0.11 M sodium acetate (Merck), 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasma ferritin was assessed in 324 samples via an ELISA (RAB0197-1KT, Merck Life Science UK Ltd). TBI was calculated using the below equation as proposed by Cook et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... was seeded in T25 flasks coated with rat tail type I collagen (Merck Millipore), in EndoGro-MV medium (Merck Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... was washed 3 times with PBS (Merck Millipore ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Cell Biology 2019Quote: ... Collagen gels containing cells were prepared by mixing type I rat tail collagen solution (Merck) with 2 x concentrated DMEM (Merck) ...
-
bioRxiv - Cell Biology 2022Quote: ... ANA12 (10 μM [cells] or 1 μg [rats] 34,35; SML0209, Sigma-Aldrich/Merck group, USA) was dissolved in DMSO / Tween 80 / sterile 0.9% NaCl solution ...
-
bioRxiv - Developmental Biology 2023Quote: ... rat anti tyrosinated-α-tubulin 1:250 (MAB1864-I, clone YL1/2, EMD Millipore/Merck), mouse anti-Armadillo/β-Catenin 1:50 (N27A1 ...
-
bioRxiv - Immunology 2024Quote: A multiplex biometric ELISA-based immunoassay was used according to the manufacturer’s instructions (MERCK cat. n. MTH17MAG-47K-05) using the Bio-Plex 200 instrument (Bio-Rad Laboratories) ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...