Labshake search
Citations for Merck :
301 - 350 of 1777 citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Microbiology 2022Quote: ... was prepared using 5× M9 minimal salts (Merck), diluted as appropriate ...
-
bioRxiv - Microbiology 2019Quote: ... For experiments using 5-FAM-rifampicin (Merck-Millipore), MLP or persistence phase cells were exposed to 1.5 µg/ml (concentration equimolar to 10x MBC rifampicin ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 µg/ml Apo-Transferrine (Merck, T2036). Explants were removed after 7 days once half of the membrane had been covered with keratinocytes and the culture was maintained by changing media every three days ...
-
bioRxiv - Immunology 2022Quote: ... 5 - 15 mM PEG-3000 (Sigma and Merck), 20 - 30 µM CA-074Me (Calbiochem) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... using spin filters (Merck, Millipore, MWCO: 5 kDa).
-
bioRxiv - Neuroscience 2020Quote: ... 5% aluminum sulfate solution (Merck Millipore, ref. 1.00121) for 5 min ...
-
bioRxiv - Microbiology 2019Quote: ... Mounted cells were fixed in 5% glutaraldehyde (Merck) in 0.1 M cacodylate (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% BSA (Merck KGaA) in TBS (Merck KGaA ...
-
bioRxiv - Biochemistry 2020Quote: ... Slides were later stained with 5% Giemsa (Merck) for 4 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... supplemented with benzonase (5 μL/g pellet, Merck) and incubated for 15 min on a shaking table ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were suspended in 5% BSA (Merck; #12659) in PBS and single cells were sorted using a BD FACSJazz system into wells of a 96-well cell culture plate ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescein-labelled ssDNA substrate (5’[FAM]-pT50; Merck) was used in all SEC experiments to allow us to characterise complexes formed on DNA in the absence of any unwinding.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 % heat-inactivated horse serum (Merck), EGF (20 ng mL−1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). At least 3 independent experiments with at least 2 independent littermate MEF clones of each genotype and each sex were performed to measure DNA damage responses ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). Four independent experiments were performed.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml holo-transferrin (Merck, cat. #T0665), 5 ng/ml EGF (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... Beads were transferred to Filter plates (Durapore PVDF membrane, Merck Millipore), washed extensively and eluted with SDS sample buffer (Eberl et al. ...
-
Discovery and Optimization of Inhibitors for the Pup Proteasome System in Mycobacterium tuberculosisbioRxiv - Microbiology 2019Quote: Thin Layer Chromatography (TLC) was performed using TLC plates from Merck (SiO2 ...
-
bioRxiv - Microbiology 2022Quote: ... Petri plate covered with a durapore membrane filter (Merck, Kenilworth, NJ) for an easy harvest of mycelia ...
-
bioRxiv - Microbiology 2019Quote: ... TLC plates (3 × 10 cm) (TLC Silica Gel 60 F254, Merck) were spotted by simply touching the end of a capillary tube containing fungal crude extract to the coated side of the TLC plates ...
-
bioRxiv - Cell Biology 2021Quote: ... were seeded onto plates coated with 0.1% gelatin solution (Merck-Millipore). Lin28a+ cells and conventional MuSCs cells were cultured in Matrigel-coated plates All cells were incubated at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... TLC was done on glass-backed Silica Gel 60 plates (Merck) with chloroform/methanol/water (10/10/3 ...
-
bioRxiv - Cell Biology 2022Quote: ... pre-coated silica gel plates (Merck TLC silica gel 60 F254). Spots were detected by a UV lamp under 254 nm or 365 nm wavelength ...
-
bioRxiv - Physiology 2021Quote: ... filtered through a 0.22 μm PVDF-based filter plate (Merck Millipore), and analyzed by LC-MS/MS ...
-
bioRxiv - Neuroscience 2021Quote: 293 cells were seeded in culture plates (Corning, Merck, Darmstadt, Germany) and incubated overnight at 37°C with 5% CO2 in DMEM (PAN Biotech ...
-
bioRxiv - Cell Biology 2021Quote: ... Thin layer chromatography (TLC) was performed on silica gel plates (Merck) with fluorescent indicator ...
-
bioRxiv - Genomics 2021Quote: ... Petri plate covered with a durapore membrane filter (Merck, Kenilworth, NJ) for easy harvest of mycelia ...
-
bioRxiv - Cell Biology 2022Quote: ... glass-bottomed plates (HPTLC silica gel 60, 10×10 cm, Merck). Pure standards of FA 6:0-NBD (Cayman Chemical ...
-
bioRxiv - Immunology 2022Quote: MultiScreen-HTS IP 96 wells filter plates (Merck Millipore, Darmstadt, Germany) were placed in 35% ethanol ...
-
bioRxiv - Neuroscience 2023Quote: NMG plates containing 10mg/ml final concentration of PTZ (P6500-MERCK) were prepared the day before the assay ...
-
bioRxiv - Microbiology 2023Quote: ... TLC plates (Silica gel 60, non-fluorescent, 0.25mm thick, Merck Millipore) were cut to a width that allowed ∼1cm between each lipid sample ...
-
bioRxiv - Cell Biology 2023Quote: ... flat-bottomed 96 well plates (Merck Life Sciences, Cat #: CLS3362-100EA) at 9,000 cells ...
-
bioRxiv - Immunology 2023Quote: ... Transfections were carried out in 6 well plates using GeneJuice (Merck) with 1 μg of plasmid DNA per well ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were then sealed with Breathe-Easy sealing membrane (Z380059, Merck) and incubated in the Biospa 8 (Biotek ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Immunology 2019Quote: ... WEHI-345 (0, 5 or 10 μM) 23 or Z-YVAD-fmk (0, 1, 5 and 10 μM; 21874; Merck, Australia) for 1 hr prior to stimulation with H ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...