Labshake search
Citations for Merck :
51 - 100 of 204 citations for PCR Tube since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... the conditioned media (CM) was collected and concentrated using AMICON Ultra-15 tubes (UFC900324, Merck Life Sciences) by centrifugation for 1 h at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... the culture media was collected and immediately transferred to Corning® 50 mL centrifuge tubes (Merck, UK) and centrifuged at 1000 ×g for 10 minutes to remove cell debris ...
-
bioRxiv - Microbiology 2021Quote: ... GGG-azide labelled proteins were concentrated to 25 μM on a 30 kDa Amicon Tube (Merck Millipore) in Tris/NaCl buffer and next labelled with 100 μM DBCO-Cy5 (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 ml EDTA tubes were prepared with 100μl protease inhibitor (Pefabloc® SC Plus, Merck KGaA, Germany) before blood collection ...
-
bioRxiv - Neuroscience 2023Quote: ... The homogenate was moved to 2 ml tubes and then 40% polysucrose 400 (P7798-100 g, Merck) in DPBS with calcium and magnesium was added in equal volumes for a final concentration of 20% ...
-
bioRxiv - Molecular Biology 2024Quote: ... then transferred to a Phase Lock Gel (PLG) tube (QuantaBio, Beverly, MA, USA) containing 0.5 mL phenol:chloroform:isoamyl alcohol (25:24:1) buffer (Merck). After thorough vortexing ...
-
bioRxiv - Immunology 2021Quote: ... The PCR product was gel purified (Illustra™ GFX PCR DNA and Gel Band Purification Kit, Merck) and used as template for in vitro transcription using the MEGAscript T7 Transcription Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2019Quote: ... PCR was performed using KOD polymerase (Merck). Samples were pooled across sub-amplicons and prepared for sequencing using NebNext Ultra II (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and GGCTGTTTAATAGGGGCTGAAC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (CAACTTACTCCTACTTGGCGT and XXXXTGCGTTGATACCACTGCTTT ...
-
bioRxiv - Immunology 2021Quote: ... Conjugated HEL-OVA solution was further purified from unconjugated proteins using a 50 kDa Amicon filter tube (Merck).
-
bioRxiv - Neuroscience 2022Quote: ... then filtered using a 0.45μm spin filter (Spin-X centrifuge tube filter, 0.45 μm Cellulose Acetate, Merck, Germany) to remove particulates ...
-
bioRxiv - Microbiology 2020Quote: ... One strain tube thawed rapidly at 37 °C and cultured in 10 ml Brain heart infusion (BHI - Merck) at 37 °C over 24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... divided into two reaction tubes and parasites were incubated either with 125 µg/ml TPCK-treated trypsin (Merck) or with 1xPBS at 37°C for 45 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... The eluates containing viral capsids were collected and transferred to an Amicon Ultra-15 filter tube (Merck Millipore). The filter tube was centrifuged at 3000 x g at 4 °C until less than 1 mL solution was left and the samples in the filter tube were subsequently washed twice with 13 mL PBS ...
-
bioRxiv - Microbiology 2023Quote: ... A fraction of the inoculum was directly transferred into 2 ml tube containing TRI reagent (Sigma-Aldrich, Merck) and silica beads (0.1 mm diameter ...
-
bioRxiv - Pathology 2023Quote: ... iodioxanol was removed and the batches concentrated by passage through Amicon Ultra-15 tubes (Ultracel-100K; Merck Millipore). AAV8 vector without sgRNA was also produced as nonediting control ...
-
bioRxiv - Cell Biology 2024Quote: ... 1x106 cells were aliquoted into 1.5 ml tubes and re-suspended in the DMEM supplemented with 10% FBS and 2.5% HEPES (H0887; Merck), and containing MycoZap plus ...
-
bioRxiv - Cell Biology 2024Quote: ... Collected peak fractions were concentrated to 10-40 µM using −50kDa centrifugal filter tube (Amicon Ultra-15, Merck). Protein concentration was measured with a NanoDrop ND-1000 spectrophotometer (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time quantitative PCR was performed using 5uL of KAPA Sybr Fast Universal 2x PCR master mix (Merck, #KK4601), 0.6uL of 5 uM forward primer ...
-
bioRxiv - Physiology 2022Quote: ... the mixture was centrifuged for 10 min at 17,000 x g before transferring the mixture to an NMR tube (Merck) for subsequent NMR analysis.
-
bioRxiv - Neuroscience 2022Quote: ... and then filtered to remove particulates using a 0.45 μm spin filter (Spin-X centrifuge tube filter, 0.45 μm Cellulose Acetate, Merck, Germany). Samples were then injected (100 µL ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral supernatants were collected after 36 h and 50 h and concentrated with Amicon ultra-15 centrifugation tubes (Merck). For storage and further usage samples were snap frozen in liquid nitrogen.
-
bioRxiv - Pathology 2022Quote: ... Nose and throat swabs were collected in tubes containing viral transport medium (15% sucrose, 2.5 μg/ml Amphotericin B [Merck] ...
-
bioRxiv - Immunology 2020Quote: ... Collected proteins were buffer exchanged into PBS via multiple rounds of centrifugation in 10 kDA ultrafiltration tubes (Merck, USA). The purified protein content was measured by Bradford assay (B6916 ...
-
bioRxiv - Microbiology 2022Quote: ... To each tube 1 μL of Tris((1-benzyl-4-triazolyl)methyl)amine (TBTA) solution (2.5 mM in DMSO; Merck), 10 μL of Tetrakis(acetonitrile)copper(I ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 8.0) and then transferred to 1.5 mL tubes prewarmed at 65°C acid-washed glass beads (G8772-100 Merck) suspended in 25 µL of 10% filtered SDS and 300 µL of acid phenol chloroform pH 4.5 ...
-
bioRxiv - Biochemistry 2024Quote: ... Dissolved IntC-UbcH5c-CAET-Ub was transferred to a dialyzer (D-Tube Dialyzer Maxi, MWCO 6– 8 kDa, Merck) in 300 mL of unfolding buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Thorough vortexing and centrifugation at 11,000 rcf for 5 min was repeated and the upper water phase containing DNA was carefully transferred to a microfuge tube with 0.5 mL H20 saturated n-butanol (Merck). Tubes were vortexed and centrifuged at 11,000 rcf for 5 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... then layered over 5ml of 70% Percoll in a 15ml tube (Percoll Merck P4937, 10% 10x PBS, 20% RPMI). The tube was then centrifuged at 1450rcf for 11mins with the break set to 1 and accelerator to 3 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR grade water (Lichrosolv®; Merck, Darmstadt, Germany). The qPCR was performed in triplicates using the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Genomics 2022Quote: ... contained in the Kap2G Robust PCR kit (MERCK) per sample and 9 μl added to each well need to be used in a 96-well plate ...
-
bioRxiv - Cell Biology 2023Quote: ... or Power SYBR Green PCR Master Mix (Merck). For all groups ...
-
bioRxiv - Genomics 2023Quote: ... PCR reactions were conducted using KAPA Taq (Merck) according to manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... frozen fresh tissue (∼20-45 mg) was placed into a 2 ml sterile microcentrifuge tube pre-loaded with ∼15-20 glass beads (Merck) while 200 μL of ice-cold methanol (Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial inoculums were subsequently prepared using the direct colony suspension method.40 Three to five bacterial colonies were obtained from the agar plate and inoculated into an Eppendorf tube containing 1 ml of cation-adjusted Muller-Hinton broth (caMHB, Merck), consisting of 20-25 mg/L calcium ions (Ca2+ ...
-
bioRxiv - Immunology 2021Quote: ... which contained as little saliva as possible were placed in a weighed Eppendorf tube and processed with 4x weight/volume of sputolysin working solution (Merck). Afterwards ...
-
bioRxiv - Neuroscience 2021Quote: ... then dialysed against the same stock of ITC buffer overnight at 4°C using 1 kDa Pur-a-lyzer tubes (Merck). Protein and RNA concentrations after dialysis were calculated by A280 and A260 absorbance respectively ...
-
bioRxiv - Biochemistry 2022Quote: ... and filtered using a 0.22 µm Corning® Costar® Spin-X® plastic centrifuge tube filter (Merck Milipore Ltd.). The concentrated sample was applied to a Superose 6 increase 5/150 column (Cytiva ...
-
bioRxiv - Cell Biology 2022Quote: ... The remaining media was then concentrated down to 500 uL using a falcon tube sized 3 kDa amicon column (UFC900308; Merck) spun at 4000 xg and 4°C for approximately 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... The capillary was emptied into a 1.5ml microfuge tube and the blood was spotted onto Whatman FTA™ Classic Cards (Merck), and left to air dry for at least 15 minutes before storing at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... both isolates were grown on SAB agar media in tissue culture flasks to minimise cross-contamination and spores were harvested in PBS/Tween20 and transferred to 2 ml screw top tubes containing 425–600 mm washed glass beads (filled to the 300 mL mark; ~50 mg) (Merck). Spores were centrifuged at max speed for 2 min using a benchtop centrifuge and the supernatant was removed ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The purest and most concentrated fractions were then dialyzed by employing a 3 kDa membrane D-Tube Dialyzer (Merck, Germany) in PBS buffer (200 mM NaCl ...
-
bioRxiv - Plant Biology 2022Quote: ... 100 μg of each sample was placed in an Amicon ultrafiltration centrifuge tube (Merck, 10 kD molecular weight cut-off), 120 μL reductant buffer (10 mM DTT ...
-
bioRxiv - Cell Biology 2023Quote: ... the supernatants of lysed cells were incubated in shake tubes over 16 h at 4°C with c-Myc antibodies (9E10 M5546, Merck). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were recovered by withdrawing a volume of 200 μL from the 30 – 40% interface of the OptiPrep density gradient and transferring to a new 2 mL Sorenson Dolphin microcentrifuge tube (Merck). Nuclei were washed with 2% BSA (in 1x PBS ...
-
bioRxiv - Genomics 2023Quote: ... DNA was fragmented in a 2 mL low-bind round bottom Eppendorf tube using a sterile 3 mm borosilicate bead (Z143928-1EA Merck) by vortexing for 1 minute at maximum speed as described in [23] ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The supernatant was passed through a 0.45 µM syringe filter before transferring into a tube containing HIS-Select Nickel Affinity Gel (Merck India) and kept on a mixer at 4°C for 3 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... then the mixture was dialyzed against histone refolding buffer at 4 □ using a dialysis tube (D-TubeTM Dialyzer Medi or Maxi, MWCO 6-8 kDa, Merck). HE buffer (10 mM HEPES ...
-
bioRxiv - Molecular Biology 2024Quote: ... The upper aqueous phase was then transferred to a new tube and mixed with 240 μL isopropanol (catalog no. 15-2320, Merck), to precipitate the RNA ...