Labshake search
Citations for Merck :
251 - 300 of 1765 citations for Oxytocin ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked with 5% milk (Merck) in PBS with 0.1% Tween 20 for 1 hour at room temperature and incubated in primary antibodies overnight at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml insulin (Merck, cat. # I6634), 5 µg/ml holo-transferrin (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ng/ml EGF (Merck, cat. #SRP3196), 50 nM dexamethasone (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... 5% glycerol) supplemented with Benzonase® (Merck) and cOmplete™ Mini EDTA-free protease inhibitor (Roche) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we used a 10×20 cm silica gel plate (Merck, Darmstadt ...
-
bioRxiv - Developmental Biology 2021Quote: ... onto fibronectin-coated fibronectin-coated plates (1:100, Merck, UK), in 300 µL of N2B27media ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were seeded onto fibronectin-coated plates (1:100, Merck) in DPBS during 1h at 37°C and grown in N2B27 media - to promote the differentiation of mESCs into a stage resembling the post-implantation epiblast ...
-
bioRxiv - Biochemistry 2019Quote: ... TLC was performed on precoated silica plates (Merck, 60 F254) using UV light (254 or 366 nm ...
-
bioRxiv - Neuroscience 2020Quote: Cell culture inserts for 6-well plate (Merck Millipore, #044003)
-
bioRxiv - Neuroscience 2019Quote: ... Slices were placed on Millicell culture plate inserts (Merck Millipore) and maintained at 35°C ...
-
bioRxiv - Microbiology 2022Quote: ... or 24 well polystyrene plates (Corning®Costar® Merck) containing TAP or Tris minimal medium (The Chlamydomonas Sourcebook ...
-
bioRxiv - Systems Biology 2022Quote: ... aluminium plates coated with 0.25 mm 60F254 silica gel (Merck) were used and visualized with UV light at l = 254 nm or l = 365 nm.
-
bioRxiv - Neuroscience 2021Quote: ... NSCs were detached from the plate using accutase (Merck Millipore), centrifuged at 300 xg for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... TLC was carried out on Kieselgel 60 F254 plates (Merck).
-
bioRxiv - Bioengineering 2019Quote: ... using glass HPTLC Silica Gel 60 F254 plate (Merck, USA). The mobile phase was a mixture of hexane ...
-
bioRxiv - Microbiology 2020Quote: ... plates were developed using TMB substrate (Merck, cat. CL07-1000). Plates were read at 450 nm within 30 min using a Multiscan GO (Thermo Fischer Scientific) ...
-
bioRxiv - Genetics 2022Quote: ... Plates were coated with 0.1% gelatin (Merck, #ES-006-B) and incubated at 37°C and 5% CO2 for 30 min before plating ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The plates were sealed with semipermeable Breathe-Easier membranes (Merck), and cells were grown in a plate shaker for three days (1,000 rpm ...
-
bioRxiv - Biochemistry 2022Quote: ... Using TLC plate aluminum foils (Silicagel 60, 20 × 20, Merck) which were cut to the desired size (minimum height of 10 cm) ...
-
bioRxiv - Biochemistry 2023Quote: ... TLC silica gel 60 F254 plates were procured from Merck, New Jersey ...
-
bioRxiv - Biochemistry 2023Quote: Pre-coated silica gel 60 F254 plates purchased from Merck were used for TLC ...
-
bioRxiv - Immunology 2023Quote: ... The disk was placed onto a blood agar plate (Merck), carrying a 5 ml nutrient soft agar overlay with 200 μL exponentially growing S ...
-
FlhE functions as a chaperone to prevent formation of periplasmic flagella in Gram-negative bacteriabioRxiv - Microbiology 2024Quote: CellASIC ONIX Microfluidic Platform and CellAsic Onix plates B04A (Merck) were used for live-cell observations ...
-
bioRxiv - Microbiology 2024Quote: ... all samples were transferred to a filter plate (Merck MultiScreen) and washed on a vacuum manifold ...
-
bioRxiv - Biochemistry 2022Quote: ... Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin, Bovine Serum, 12659, Merck Millipore) powder solved in 1 × TBST ...
-
bioRxiv - Developmental Biology 2021Quote: ... The HPLC was equipped with a hydrophilic ZIC-pHILIC column (150 × 2.1 mm, 5 μm) with a ZIC-pHILIC guard column (20 × 2.1 mm, 5 μm, Merck Sequant). 5ul of each sample was used for each assay ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Microbiology 2022Quote: ... were washed with RPMI 2%G by applying 5 psi perfusion for 5 min using the CellASIC® ONIX2 microfluidic system (version 1.0.4 Millipore Merck). Yeasts were loaded into the CellASIC culture chambers by applying 8 psi for 5 s twice (Thomson et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were incubated with Prussian’s blue solution containing ferrocyanide acid solutions (5% Hydrochloric acid (HCl) and 5% potassium ferrocyanide (Merck)) at a 1:1 ratio for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5 ml conditioned medium was centrifuged (5 min, 500g) and filtered through Amicon Ultra-0.5 Centrifugal Filter unit (Merck). Ammonia in TIFs and SCFs was then quantified using Dimension Ammonia assay (Siemens ...
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Microbiology 2022Quote: ... was prepared using 5× M9 minimal salts (Merck), diluted as appropriate ...
-
bioRxiv - Microbiology 2019Quote: ... For experiments using 5-FAM-rifampicin (Merck-Millipore), MLP or persistence phase cells were exposed to 1.5 µg/ml (concentration equimolar to 10x MBC rifampicin ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 µg/ml Apo-Transferrine (Merck, T2036). Explants were removed after 7 days once half of the membrane had been covered with keratinocytes and the culture was maintained by changing media every three days ...
-
bioRxiv - Immunology 2022Quote: ... 5 - 15 mM PEG-3000 (Sigma and Merck), 20 - 30 µM CA-074Me (Calbiochem) ...