Labshake search
Citations for Merck :
1 - 50 of 2270 citations for Mouse Protein L Isoaspartate PCMT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: ... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Respective ELISA kits (insulin, leptin, IL-6 – MilliPlex Map Mouse Adipokine kit, Merck, Germany ...
-
bioRxiv - Cell Biology 2021Quote: ELISA was performed to detect serum GH (rat/mouse growth hormone ELISA kit, Merck KGaA, Dermstadt, Germany), IGF-1 (mouse/rat IGF-1 ELISA kit ...
-
bioRxiv - Neuroscience 2023Quote: ... We measured Leptin levels using mouse leptin ELISA kit (Merck Life Sciences) according to manufacturer’s instructions.
-
bioRxiv - Physiology 2020Quote: Insulin concentrations were measured by ELISA (EZRMI-13K Rat/Mouse insulin ELISA, Merck Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: Serum insulin was determined using a rat/mouse insulin ELISA kit (Millipore, Billerica, Merck KGaA, USA) as instructed ...
-
bioRxiv - Neuroscience 2021Quote: ... The concentrations of Aβ40 and Aβ42 were determined in brain lysates using the ELISA kits according to the manufacturer’s instructions (human Aβ40 and Aβ42 brain ELISA, Merck).
-
bioRxiv - Cell Biology 2021Quote: ... The supernatants were then used to quantify the level of adiponectin using Mouse Adiponectin ELISA kit (Merck Millipore #EZMADP-6 K) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... GLP-1 (GLP-1 total ELISA kit, Merck, Darmstadt, Germany) and biochemical parameters including ALT ...
-
bioRxiv - Neuroscience 2021Quote: ... and high-sensitivity GLP1 Active ELISA kit were acquired from Merck Millipore (Billerica ...
-
bioRxiv - Microbiology 2021Quote: ... the serum levels of total GLP-1 (ELISA kit, Merck, Darmstadt, Germany) and IAA (ELISA kit ...
-
bioRxiv - Developmental Biology 2022Quote: ELISA kits were used for measurements Growth Hormone (Merck-SIGMA EZRMGH-45K) according to manufacturers’ instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... Plasma leptin and insulin levels were measured by murine ELISA kits (Merck Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... Secondary antibodies included: goat anti-mouse IgG antibody (Merck Millipore AP308P, (H+L) HRP conjugate ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The L-lactate concentration was measured using a L-lactate Assay Kit (Sigma-Aldrich MAK329, Merck, France). 20 μL of pre-treated and 0.4 μm filtered feces samples were used for each reaction ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and insulin levels were estimated using a total rat insulin ELISA kit (Merck Millipore, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-neurofilament-H protein (clone NE14; Merck, Darmstadt, Germany); mouse anti-dephosphorylated neurofilament protein (clone smi32 ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-neurofilament-H protein (clone NE14; Merck, Darmstadt, Germany); rabbit anti-IBA1 (Polyclonal IgG ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... the mouse anti-ubiquitinated proteins 1:1000 (04-263, Merck), the rabbit anti-LC3B 1:1000 (NB600-1384 ...
-
bioRxiv - Genomics 2019Quote: ... and 100 Units/ml of Recombinant mouse LIF Protein (Merck ESG1107). Culture were seeded at an average density of ∼ 3.8*104 cells/cm2 and passaged every 48 h.
-
bioRxiv - Bioengineering 2022Quote: ... Protein concentrations were determined with the BCA protein assay kit (Novagen, Merck KGaA), and protein homogeneity was analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE ...
-
bioRxiv - Cancer Biology 2021Quote: Intracellular protein was extracted from cells using the NucBuster Protein Extraction Kit (Merck) and quantified using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentration was estimated using BCA protein assay kit (Merck, 71285-3, Germany).
-
bioRxiv - Neuroscience 2021Quote: ... protein concentration was quantified using a Sigma-Aldrich BCA protein assay kit (Merck). Subsequently ...
-
bioRxiv - Immunology 2023Quote: ... using Mouse Kapa Genotyping kit (Merck-Millipore), primers (500 nM ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Nunc MaxiSorp ELISA plates (M9410, Merck), 10% BSA ELISA reagent diluent/blocking solution concentrate (DY995 ...
-
bioRxiv - Microbiology 2024Quote: ... and phytohemagglutinin-L (PHA-L; Merck) at 2μg/ml for 72h ...
-
bioRxiv - Neuroscience 2019Quote: ... Antibodies used: green fluorescent protein (GFP) mouse monoclonal (MAB3580; Merck; 1:1,000); EPAC2 monoclonal (A-7 ...
-
bioRxiv - Physiology 2020Quote: ... Total proteins from the supernatant were quantified using a Bradford Protein Assay Kit (Merck) and subjected to electrophoresis on 15% SDS–PAGE gels ...
-
bioRxiv - Physiology 2022Quote: ... Protein carbonylation was assessed with an Oxyblot protein oxidation detection kit (#S7150, Merck Millipore) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... RIPA and FA fractions was assessed using the Human Aβ1-42 enzyme-linked immunosorbent assay (ELISA) Kit (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... and quantified by ELISA (Merck, EZRMI-13K). Diurnal sampling of blood for glucocorticoid profiling was performed (0800h and 2000h ...
-
bioRxiv - Molecular Biology 2024Quote: ... FLAG-tagged proteins were detected using M2 anti-FLAG antibody (mouse, F1084, Merck) followed and fluorescent Anti-Mouse Alexa Fluor™ Plus 800 ...
-
bioRxiv - Molecular Biology 2022Quote: Millipore Compartment Protein Extraction Kit (Merck-Millipore, Cat. #2145) was used to deplete cytosolic ...
-
bioRxiv - Physiology 2022Quote: ... To detect total protein carbonylation by immunoblot we used the OxyBlot Protein Oxidation Detection kit (Merck) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates were measured for protein concentration using a Non-Interfering protein Assay kit (cat#488250, Merck Millipore ...
-
bioRxiv - Plant Biology 2024Quote: ... L-kynurenine (Merck), pyrazinamide (Merck ...
-
bioRxiv - Cell Biology 2023Quote: Protein carbonyl formation by oxidative reactions was assessed with the OxyBlot Protein Oxidation Detection Kit (S7150, Merck Millipore), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by incubation with a rabbit anti-Kv4.3 primary antibody (1:10000, Alomone Labs) together with chicken (G)/mouse (L) anti-TH primary antibody (1:1000, Abcam / Merck) in a carrier solution (1% NGS ...
-
bioRxiv - Microbiology 2022Quote: ... 4mg/L tobramycin (TOB) or 16mg/L LL-37 (Merck, UK), to a final volume of 200μL ...
-
Critical contribution of mitochondria in the development of cardiomyopathy linked to desmin mutationbioRxiv - Pathology 2023Quote: ... Soluble proteins were then dosed using the Bicinchoninic Acid Kit (Merck) and diluted in Laemmli protein sample buffer ...
-
bioRxiv - Immunology 2022Quote: ... The protein concentration of ES antigen was estimated using protein estimation kit by Bradford method (Merck GeNei™, Bangalore).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The eluted corona proteins from nanoparticles were first precipitated by using the ProteoExtract® Protein Precipitation Kit (Merck, Germany) as described in the manufacturer protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... and mouse monoclonal IgG2A antibody to myelin Proteolipid Protein (clone PLPC1, MAB388, MERCK-Millipore, 1:100). All slides were mounted using Mowiol mounting medium (475904 ...
-
bioRxiv - Cell Biology 2021Quote: ... The main culture (TB medium: 0.9 L, 1.2 g/L NH4SO4 (Merck), 0.041 g/L KH2PO4 (Merck) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 20 g/L peptone (Difco) and 20 g/L glucose (Merck Millipore). Synthetic complete medium without uracil (SC-URA) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Pramlintide was quantified by ELISA (Merck Millipore, cat # EZHA-52) according to manufacturer instructions ...
-
bioRxiv - Biophysics 2023Quote: ... L-glutamine (Merck KGaA), L-Arginine (Carl Roth GmbH) ...
-
bioRxiv - Neuroscience 2019Quote: Plasma levels of adiponectin and leptin were measured using commercially available kits (Human Leptin Enzyme Immunoassay, Merck, Cat. #A05174 and Human Adiponectin ELISA, Merck, Cat. # EZHADP-61K). The minimum detectable dose of leptin was 7.8 pg/mL and that of adiponectin was 0.891 μg/mL.