Labshake search
Citations for Merck :
101 - 150 of 3497 citations for Mouse IgG2b Isotype Control Antibody A 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-cortactin monoclonal antibody (Merck, 05-180), mouse anti-tubulin monoclonal antibody (GeneTex GTX628802) ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were transferred to well-plates for exposure to two primary antibodies (RFP antibody 5F8 rat for mCherry, RRID: AB_2336064, Chromotek, 1:1000; and mouse-monoclonal anti-CaMKIIα, RRID: AB_309787, Merck Millipore, 1:300) which were added to 0.1 M PBS-Tx 0.2% containing 5% normal goat serum ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then treated with antibodies against FLAG (Monoclonal ANTI-FLAG® M2 antibody produced in mouse; Merck CAT# F3165; 1:200 dilution) or CSNK1D (Anti-Casein Kinase 1 delta/CSNK1D antibody [AF12G4] ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary and secondary antibodies used were: monoclonal mouse anti-puromycin (clone 12D10, MABE343, Merck Millipore; 1:1000), polyclonal rabbit anti-Tau (T6402 ...
-
bioRxiv - Cell Biology 2020Quote: ... c-Src was detected using anti-Src (GD11 clone) antibody (1:200, Merck Millipore, Mouse, 05-184). Phosphorylated c-Src was assessed using anti-phospho-Src Tyr 418 antibody (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated overnight at 4 °C with primary antibodies against puromycin (mouse monoclonal 1:500, Merck), Par3 (rabbit polyclonal 1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated overnight at 4 °C with an anti-puromycin antibody (mouse monoclonal 1:500, Merck) combined with an anti-β-actin antibody (rabbit polyclonal 1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... primary antibody and with mouse monoclonal anti-map2 primary antibody (Merck Millipore, MAB3418). The secondary antibodies used were the anti-Rabbit Alexa Fluor 546 (Thermo fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Secondary antibodies included: goat anti-mouse IgG antibody (Merck Millipore AP308P, (H+L) HRP conjugate ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse TAP952 (1:500, Merck). For testing the expression of TTLL5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or non-targeting siRNA control (MISSION siRNA universal negative control UNC2; Merck) using Lipofectamine RNAiMAX Reagent (ThermoFisher) ...
-
bioRxiv - Neuroscience 2019Quote: ... before probing overnight at 4°C with primary antibodies (1:500 mouse anti-NF200 [N0142; Sigma-Aldrich] and 1:500 rabbit anti-peripherin (AB1530; Merck Millipore) in blocking solution ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were also probed with either a mouse monoclonal antibody against GAPDH or a mouse monoclonal antibody against beta-actin (dilutions of 1:10,000 and 1:1000; Sigma-Aldrich/Merck group, USA) and with the IRDye® 680CW secondary antibody from Eurobio Ingen (926-32220 ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
CAP1 and cofilin1 cooperate in neuronal actin dynamics, growth cone function and neuron connectivitybioRxiv - Neuroscience 2020Quote: ... mouse anti tau-1 (1:200, Merck Millipore), mouse anti-c-Myc (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated overnight at 4°C with monoclonal anti-NeuN antibody (1:500; Mouse, MAB377, Merck Millipore), in a 50% dilution of blocking buffer + 0.5% Triton X-100 ...
-
bioRxiv - Cell Biology 2024Quote: ... cover slips were incubated with the primary antibody (SV40 T antigen mouse-anti-human, Merck-Millipore, 1:50) overnight at 4 °C in a humidifier chamber ...
-
bioRxiv - Molecular Biology 2019Quote: Primary antibodies used: mouse anti-Flag (M2 F3165, Merck), mouse anti-DDX11 (D-2 271711 ...
-
bioRxiv - Biochemistry 2021Quote: ... Mouse anti-Myc tag antibody was purchased from Merck Millipore (Bangalore ...
-
bioRxiv - Neuroscience 2021Quote: ... or mouse monoclonal anti-β-actin antibody (A5316, Merck) diluted in TBST ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-tubulin α mouse monoclonal antibody (Merck Chemicals GmbH), and anti-p230 mouse monoclonal antibody (BD Biosciences) ...
-
bioRxiv - Biophysics 2021Quote: anti-α-tubulin IgG mouse monoclonal antibody (T5168, Merck), dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-α-tubulin IgG mouse monoclonal antibody (T5168, Merck); mouse anti-tau (Tau13) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-α-Tubulin mouse monoclonal (DM1A) antibodies (#T6199) (Merck); anti-DAPK3 polyclonal antibodies (#PA5-90193 ...
-
bioRxiv - Biochemistry 2020Quote: ... as primary antibodies and HRP conjugated anti-mouse or anti-rabbit secondary antibodies (Merck).
-
bioRxiv - Cancer Biology 2022Quote: ... filters were incubated for 1 hour at RT with either goat-anti rabbit (1:5000) or goat-anti mouse (1:2000) horseradish peroxidase (HRP)-conjugated secondary antibodies (Merck Millipore, Darmstadt, Germany). Blots were developed using SuperSignal West Pico Chemiluminescent Substrate or Femto Maximum Sensitivity (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... and incubated o/n at 4°C with the primary antibodies (Rabbit-antiGFAP: MAB3402, Merck Millipore, 1:500; Mouse-antiNeuN: MAB377, Merck Millipore, 1:500) diluted in the blocking solution ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-synaptopodin (Merck, 1:500), rabbit anti-calreticulin (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-TH (Merck, 1:1000), mouse anti-Bassoon (Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-Mad1 (1:1,000; Merck), rabbit anti-Kif4a (1:1,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-MPM2 (1:1,000, Merck), mouse anti-GAPDH (1:50,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-TH (1:5000, Merck-Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... brain sections were subjected to immunohistochemistry using a mouse anti-NeuN antibody (MAB377; Merck, Kenilworth, NJ, USA; 1:500) followed by incubation with an anti-mouse IgG antibody (Vector Laboratories ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary antibodies diluted in 5% milk/PBS-Tween were: mouse anti-Actin (1:2000; Merck, Germany, Cat. No. MAB1501), rat anti-MYC (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... The sections were then incubated overnight in PBS with 0.2% BSA and 0.05% Tween-20 with primary antibodies directed against SARS-CoV-2 Nucleocapsid Protein (1:500; mouse monoclonal, # ZMS1075, Merck); Iba1 (1 ...
-
bioRxiv - Genetics 2021Quote: ... a mouse anti-actin monoclonal antibody (#MAB1501R, used at 1:5,000 dilution for the Western blot analyses, Merck Inc.); a mouse anti-glyceraldehyde-3-phosphate dehydrogenase monoclonal antibody (#MAB374 ...
-
bioRxiv - Immunology 2021Quote: ... followed by incubation with a 1:5000 dilution of a donkey anti-mouse IgG HRP antibody (AP192P, Merck Millipore). Protein detection was performed using SuperSignal West Pico PLUS (34579 ...
-
bioRxiv - Physiology 2022Quote: ... monoclonal anti-α-actinin (Sarcomeric) antibody produced in mouse (1:1000, Sigma-Aldrich, Merck, clone EA-53, Cat# A7811), at 4°C overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... This was followed by application of a Cy3-conjugated goat anti-mouse antibody (1:250 dilution, #AP124C; Merck Millipore) as the secondary antibody ...
-
bioRxiv - Microbiology 2024Quote: ... Whole cell samples were then analysed by immunoblot using anti-puromycin antibody (1:2000, anti-mouse, clone 12D10, Merck). As a loading control a duplicate SDS-PAGE was performed ...
-
bioRxiv - Molecular Biology 2023Quote: The shRNA sequence in pLKO.3-GFP lentiviral vector against mouse KIS was GAGTGCGGAGAATGAGTGTTT (MISSION shRNA library, TRCN0000027622) and control non-mammalian shRNA was from Merck-Sigma (SHC002) ...
-
McIdas localizes at centrioles and controls centriole numbers through PLK4-dependent phosphorylationbioRxiv - Molecular Biology 2022Quote: ... mouse anti-Centrin (1:500-1:1000, Merck Millipore), chicken anti-GFP (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse monoclonal anti-S-100 β subunit antibody (S2532, Merck), rat monoclonal anti-CD68 antibody (ab53444 ...
-
bioRxiv - Neuroscience 2020Quote: ... and immunostained with a mouse anti-NeuN antibody (Merck Millipore). Fluorescence images were acquired with a confocal laser-scanning microscope (TCS SP8 ...
-
bioRxiv - Biophysics 2021Quote: goat anti-mouse IgG Atto594-labeled monoclonal antibody (76085, Merck), dilution ...
-
bioRxiv - Genetics 2019Quote: ... 8) anti-CREB3L1 mouse monoclonal antibody 44c7 (Merck Millipore, MABE1017) (dilution 1:1000) ...
-
bioRxiv - Immunology 2023Quote: ... mouse anti-Phosphotyrosine (clone 4G10) (3560614) antibody was from Merck Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated with mouse anti-EGFR antibody (#GR01; Merck Millipore) or mouse IgG control in 0.1% BSA/PBS for 30 min on ice ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were stained with mouse monoclonal 4G2 antibody (Merck Millipore) and AlexaFluor488 anti-mouse secondary antibody (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membrane was incubated with primary mouse anti-actin antibody (Merck) at a 1:8000 dilution in blocking buffer at 4°C o/n ...