Labshake search
Citations for Merck :
101 - 150 of 1065 citations for Mouse Direct PCR Kit For Genotyping since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2022Quote: ... mouse anti-GAPDH (CB1001, Merck), rabbit phospho-Rb Ser807/811 (8516 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-NeuN (Merck, MAB377), mouse anti-parvalbumin (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse monoclonal anti-Rac1 (Merck Millipore ...
-
bioRxiv - Cell Biology 2023Quote: ... BUBR1 (mouse mAb, Merck, MAB3612), CENP-A (mouse mAb ...
-
bioRxiv - Cell Biology 2023Quote: ... tubulin (mouse mAb; Merck, T6199), BUB1 (rabbit pAb ...
-
bioRxiv - Microbiology 2022Quote: ... mouse anti-puromycin (Merck, MABE343) (1:10.000) ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse anti-vinculin (V9131, Merck); rabbit anti-pYAP S127 (D9W21 ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse TAP952 (1:500, Merck). For testing the expression of TTLL5 ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse anti-Vinculin (V9131, Merck), anti-Col1A1 (91144S ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse anti-Vinculin (V9131, Merck); anti-Col1A1 (91144S ...
-
bioRxiv - Immunology 2023Quote: ... and goat anti-mouse (Merck).
-
bioRxiv - Neuroscience 2024Quote: ... or mouse anti-GAPDH (Merck) was diluted 1:1000 in blocking buffer ...
-
bioRxiv - Genomics 2024Quote: ... Mouse anti-NeuN antibody (Merck Millipore ...
-
bioRxiv - Genomics 2021Quote: ... PCR products were cleaned up using the illustra™ ExoProStar™ enzymatic PCR and sequence reaction clean kit according to the manufacturer’s instructions (Merck KGaA, Darmstadt, Germany). Cycle sequencing was performed using the BigDye™ Terminator v3.1 Cycle Sequencing kit and products were purified with the BigDye XTerminator™ purification kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2019Quote: ... PCR was performed using KOD polymerase (Merck). Samples were pooled across sub-amplicons and prepared for sequencing using NebNext Ultra II (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (GTCTTGGTCATAGACACTGGTAG and GGCTGTTTAATAGGGGCTGAAC ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed using KOD polymerase (Merck) and the following primers (CAACTTACTCCTACTTGGCGT and XXXXTGCGTTGATACCACTGCTTT ...
-
bioRxiv - Microbiology 2023Quote: ... SPN infected A549s were fixed with chilled methanol followed by further processing with Duolink® In Situ Orange Starter Kit Mouse/Rabbit (MERCK, DUO92102-IKT) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time quantitative PCR was performed using 5uL of KAPA Sybr Fast Universal 2x PCR master mix (Merck, #KK4601), 0.6uL of 5 uM forward primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse anti-Flag M2 (F1804, Merck), rabbit anti-SOH (07-2139 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-Vinculin (#V9131-100UL, Merck), rabbit anti-TBK1 (ab40676 ...
-
bioRxiv - Neuroscience 2019Quote: ... mouse anti-synaptopodin (Merck, 1:500), rabbit anti-calreticulin (Abcam ...
-
bioRxiv - Biochemistry 2019Quote: ... Mouse anti-tau (1E1/A6, Merck) or rabbit anti-αS (ab138501 ...
-
bioRxiv - Microbiology 2019Quote: ... mouse α-Lamin B1 (MAB5492, Merck), mouse α-PCNA (c907 ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-TH (Merck, 1:1000), mouse anti-Bassoon (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-PSA-NCAM (Merck Millipore), rat anti-NCAM2 (R&D Systems) ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-GAD67 (mouse monoclonal from Merck), anti-cleaved Caspase-3 (rabbit polyclonal from Cell Signaling Technology) ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse monoclonal anti-Creb3L2 (Merck, MABE1018) and anti-GAPDH (Genetex ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-NeuN (Merck Millipore, MAB377); rabbit anti-GAPDH (Santa Cruz ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Anti-NeuN Antibody (Merck, #MAB377), rabbit Anti-Neurofilament 200 antibody (Merck ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-CaMKII (Merck Millipore, Sweden), mouseanti-ankyrin-G (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... and SFPQ (mouse monoclonal, Merck, P2860). Primary antibodies of NONO and SFPQ were diluted 1:1,000 in 5% milk PBST ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-GAD67 (Merck Millipore, Sweden), mouse anti-CaMKII (Merck Millipore ...
-
bioRxiv - Developmental Biology 2020Quote: ... and mouse anti-GAPDH (Merck, G8795). Scanned images were quantified using Metamorph after monochrome inversion.
-
Developmental effects of oxytocin neurons on social affiliation and processing of social informationbioRxiv - Neuroscience 2021Quote: ... (mouse monoclonal, MAB 318, Merck Millipore).
-
bioRxiv - Immunology 2020Quote: ... and mouse (12-371, Merck Millipore) IgGs ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-NeuN (mouse monoclonal from Merck), anti-cFos (rabbit polyclonal from Cell Signaling Technology) ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-GFAP (mouse monoclonal from Merck), CD68 (rat monoclonal from Abcam) ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse monoclonal anti-DIC74.1 (MAB1618, Merck), 0.33 μg.ml-1 mouse monoclonal anti-GAPDH (AM4300 ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse monoclonal anti-Aβ (Merck, MABN639).
-
bioRxiv - Cell Biology 2022Quote: ... PLA Probe Anti-Mouse PLUS (Merck) and PLA Probe Anti-Rabbit MINUS (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-Mad1 (1:1,000; Merck), rabbit anti-Kif4a (1:1,000 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-MPM2 (1:1,000, Merck), mouse anti-GAPDH (1:50,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-TH (1:5000, Merck-Millipore ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-HP1α (#MAB3584, Merck Millipore), rabbit anti-HP1π (1:1,000,#8676 ...
-
bioRxiv - Immunology 2023Quote: ... mouse anti-NeuN (#MAB377) from Merck Millipore (Burlington ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-tubulin acetylated (Merck, #T6793), rabbit anti-CENPJ (Invitrogen,#PA597577 ...
-
bioRxiv - Molecular Biology 2022Quote: ... mouse Tie2 (Merck, cat. #05-584), pY992 Tie2 (R&D Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal anti-HMGCR (Merck, #MABS1233), rabbit polyclonal anti-Synoviolin (Hrd1 ...
-
bioRxiv - Bioengineering 2023Quote: ... mouse anti-β-tubulin (T8328, Merck); mouse anti-vinculin (V9131 ...