Labshake search
Citations for Merck :
451 - 500 of 5085 citations for Mouse Anti Dengue Virus Envelope Protein Serotypes 1 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... 8) anti-CREB3L1 mouse monoclonal antibody 44c7 (Merck Millipore, MABE1017) (dilution 1:1000) ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-GABA A Receptor β 2,3 (mouse monoclonal from Merck), anti-GABA A Receptor γ (guinea pig polyclonal from SYSY) ...
-
bioRxiv - Immunology 2023Quote: ... mouse anti-Phosphotyrosine (clone 4G10) (3560614) antibody was from Merck Millipore ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Duolink in situ PLA probe anti-mouse MINUS (Merck), and Duolink Detection Reagents Red or Green (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit and mouse anti-PH3 (MERCK and Cell Signal Technology) 1:500 ...
-
bioRxiv - Cell Biology 2024Quote: ... The primary anti-PMCA4 JA9 mouse monoclonal antibody (P1494, Merck) was used at a 1:200 dilution at 42°C for 32 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and incubated with mouse anti-EGFR antibody (#GR01; Merck Millipore) or mouse IgG control in 0.1% BSA/PBS for 30 min on ice ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse monoclonal anti-γH2A.X (05-636, Merck-Millipore, Darmstadt, Germany), mouse monoclonal anti-H3K4me3 (72 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membrane was incubated with primary mouse anti-actin antibody (Merck) at a 1:8000 dilution in blocking buffer at 4°C o/n ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Molecular Biology 2019Quote: Inflorescences were harvested into fresh fixative (3:1 96% ethanol (Merck) and glacial acetic acid ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein was concentrated to ∼500 μL using Amicon Ultra-15 Centrifugal Filter Units (Merck Millipore MWCO 3 kDa). The concentration of proteins was determined using JASCO V730 UV-vis spectrophotometer at 280 nm ...
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... Virus was then concentrated using Amicon Ultra-4 centrifugal filter units (Merck-Millipore) and the solution was filtered with a 0.2 µm Acrodisc syringe filter (Sigma-Aldrich).
-
bioRxiv - Physiology 2021Quote: ... The virus was further purified using Sepharose G100 SF resin (Merck, Darmstadt, Germany) in Econopac colums (Bio-Rad ...
-
bioRxiv - Physiology 2021Quote: ... Virus was concentrated in PBS using Amicon Ultra-15 Centrifugal Filter Units (Merck) and stored at 4°C.31,77,78 Viral titre was quantified by inverted terminal repeat probe quantitative polymerase chain reaction (PCR) ...
-
bioRxiv - Biochemistry 2023Quote: ... Virus- containing supernatant P1 was sterile-filtered using a 0.22 μm filter (Merck). To amplify the virus 1.5 mL P1 was added to 250 mL of Sf21 shaking cell culture at a density of 0.4*106 cells/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... Mouse monoclonal anti vinculin (V9131) and rabbit polyclonal anti beta actin (A2066) were from Merck. Rabbit polyclonal antibodies to ARL8b (A88749) ...
-
bioRxiv - Developmental Biology 2022Quote: ... immunofluorescence staining was performed using overnight incubation with polyclonal anti-Prosurfactant Protein C (ProSP-C) (Merck/Millipore/Sigma Aldrich, 1:500) followed by staining with polyclonal secondary antibody Goat anti-rabbit Alexa fluor 488 (Invitrogen,1:500) ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were washed 3 times with PBS-T for 5 min and incubated with mouse-HRP (A4416; Merck) and rabbit-HRP (GENA9640V ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:50 Hyaluronan binding protein HABP (#H0161; Merck, Germany) or 1:100 mouse anti-Neurocan (#N0913 ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit anti-PRRX16 (1:200) rabbit anti-Laminin (Merck, #L9393 1:200). Secondary antibodies used in these studies were procured from Thermo Fisher Scientific (Waltham).
-
bioRxiv - Genetics 2020Quote: ... Protein extraction and Western blot using anti-puromycin antibody (Merck Millipore) was performed as described before.
-
bioRxiv - Biophysics 2021Quote: ... The antibody was revealed using Atto 594 goat anti-mouse IgG (1:500, 76085-1ML-F, Merck & Co., Kenilworth, NJ, USA). The coverslips were rinsed in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the slides were incubated for 1 h at room temperature with the appropriate biotin-conjugated secondary antibody: goat anti-mouse (21538, Merck-Millipore) for CD3 and goat anti-rat (BP-9400 ...
-
bioRxiv - Microbiology 2021Quote: ... The binding of CoVHH1-FLAG to S1 subunits-His tag was detected by incubating for 1 hour at room temperature with mouse monoclonal ANTI-FLAG® M2-Peroxidase (Merck) diluted with PBST ...
-
bioRxiv - Immunology 2019Quote: ... and mouse monoclonal anti-DNA/Histona H1 antibody (1:100; catalog number 05-457/clone AE-4; Merck Millipore, MA, EUA). Alternatively ...
-
bioRxiv - Neuroscience 2021Quote: Immunohistochemical staining was performed on free-floating brain sections using the following primary antibodies: mouse anti-rat TH (1:4000, MAB318, Merck Millipore), rabbit anti-Girk2 (1:500 ...
-
bioRxiv - Immunology 2021Quote: ... blocked in 5% BSA for 30 min and incubated ON with mouse anti-GAD67 monoclonal antibody (1:6000, MAB5406, Merck Millipore) or 1 h with rabbit polyclonal anti-GAPDH antibody (1:3000 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... slices were incubated for 24-48h at 4°C with mouse anti-Neurophysin I (1:2000, Merck Millipore, marker for Oxytocin), rabbit anti-vasopressin (1:1000 ...
-
Autoimmune inflammation triggers aberrant astrocytic calcium signaling to impair synaptic plasticitybioRxiv - Neuroscience 2023Quote: ... The purity of the cultures was be routinely assessed by examining the characteristic cell morphologies under phase-contrast microscopy and confirmed by immunostaining with mouse anti-GFAP (1:200; Merck, MAB3402) and mouse anti-S100β (1:400 ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were incubated in a 10% (v/v) HS PBS solution supplemented with primary mouse anti-β-tubulin III antibody (1:100; Merck) overnight at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse mono-ubiquitylated histone H2A (1:75, Merck, 32160702), Maged1(1/300 ...
-
bioRxiv - Neuroscience 2023Quote: ... NeuN (monoclonal mouse, 1:1000, MAB377, Merck Millipore, USA), NG2 (polyclonal rabbit ...
-
bioRxiv - Biochemistry 2023Quote: ... The eluted protein was concentrated and using using Amicon Ultra-15 centrifugal filters (3 kDa cut-off, Merck-Millipore) and then buffer was exchanged to buffer B (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Neuroscience 2020Quote: ... and an Alexa Fluor 488-conjugated mouse anti-NeuN antibody (Merck Millipore ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-GFP from mouse IgG1κ (clones 7.1 and 13.1) (Merck; 11814460001) were used when monoclonal Anti-HA antibodies produced in mouse (Merck ...
-
bioRxiv - Microbiology 2021Quote: ... and secondary (goat anti-mouse IgG, Merck Millipore, cat. no. AP124P) antibodies ...
-
bioRxiv - Immunology 2020Quote: ... 100 μL of anti-mouse IgG (Fc-specific)−biotin (Merck B7401) were added and incubated for 45 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primary antibodies used were mouse anti-EGFR antibody (#GR01; Merck Millipore), goat anti-EEA1 (#sc-6414 ...
-
bioRxiv - Microbiology 2023Quote: ... A commercial mouse anti-DENV complex monoclonal antibody (MAB8705; Merck Millipore) diluted 1:200 in phosphate-buffered saline (PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... and 3-OCT (1:167, Merck, Darmstadt, Germany, CAS #589-98-0) were diluted in mineral oil (Thermo Fisher ...
-
bioRxiv - Biophysics 2023Quote: ... concentrated virus particles were freshly thawed and diluted in phosphate-buffered saline (PBS, Merck, 806552 ...
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
Obesity alters mobility and adult neurogenesis, but not hippocampal dependent learning in ob/ob micebioRxiv - Neuroscience 2019Quote: ... the solution containing the primary rabbit anti-active Caspase 3 antibody (Merck Millipore, Germany) was applied 1:100 in blocking serum (3 % NGS + 0.1 % Triton X-100 in PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Neuroscience 2022Quote: ... for 5 min each at RT and incubated with secondary antibodies in TPBS-TS-1% for 4h at 4°C (Alexa Fluor 546 anti-Mouse (Merck, A-11018), Alexa Fluor 488 anti-goat (Abcam ...