Labshake search
Citations for Merck :
201 - 250 of 4022 citations for Mono 2 Ethyl 5 Hydroxyhexyl Phthalate 13C4 99% Dehp Metabolite Ix 100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... or with 5 μg/ml α-amanitin (Merck, A2263) as indicated in the text.
-
bioRxiv - Microbiology 2020Quote: ... Nuclei were stained with 5 μg/ml Hoechst (Merck). Images were taken at 630-fold magnification on a Leica DM 5000B microscope with a Leica DFC 300 FX camera ...
-
bioRxiv - Biophysics 2022Quote: ... and 5 mg/mL α-casein (Merck, Darmstadt, Germany) (7 ...
-
bioRxiv - Microbiology 2022Quote: ... Nuclei were stained with 5 µg/ml Hoechst (Merck) in PBS for 30 min.
-
bioRxiv - Neuroscience 2022Quote: ... 5 µg/mL Heparin (MERCK, Cat. no. H3149-25KU), 1X N2 Supplement ...
-
bioRxiv - Neuroscience 2023Quote: ... 1mM sodium pyruvate and 5 µg/ml insulin (Merck)) and B27 media (Neurobasal supplemented with 1X B27 and 2mM L-Glutamine (ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with insulin 5 μg/ml (Merck, I6634-250MG), hydrocortisone 1 μg/ml (Voden ...
-
bioRxiv - Plant Biology 2022Quote: ... 2% Triton X-100) supplemented with 1X plant protease inhibitor (Merck). Cellular debris was removed by several centrifugation steps at 8,000 x g for 10 min at 4 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... 2% Triton X-100) supplemented with 1x plant protease inhibitor (Merck). Cell debris was removed by several centrifugation steps at 8,000 x g for 10 min at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM, Merck, A7007) used as a primary methyl donor molecule ...
-
bioRxiv - Molecular Biology 2022Quote: ... A SeQuant ZIC-pHILIC (2.1×100 mm, 5-μm particle) column (Merck) used for chromatographic separation ...
-
bioRxiv - Cell Biology 2021Quote: ... Treatment with 2 µM hydrogen peroxide for 5 min (H2O2; Merck) was used to induce DNA strand-breaks and oxidative damage ...
-
bioRxiv - Genetics 2022Quote: ... 90 μl 5 M NaCl and 2 μl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... determined by means of quantitative NMR using TraceCERT® ethyl 4-(dimethylamino)benzoate from Merck as an internal calibrant [48 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 ml/well of overlay [MEM containing 2% FBS and 0.4% tragacanth (Merck, Israel)] was added to each well and plates were incubated at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... metabolites were extracted from conditioned media by dilution (1:10) in ice-cold methanol (Merck, Darmstadt, Germany) containing 3-nitro-L-tyrosine [5 µM] (Merck ...
-
bioRxiv - Plant Biology 2019Quote: ... fresh stem sections were counterstained for 5 min by 5 µg/ml propidium iodide (PI, Merck) dissolved in tap water or 0.01 % Direct Red 23 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 ng/ml cholera toxin (Merck, Cat Number: C8052-1MG), 10 μg/ml insulin (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... MEFs were treated with 100 ng/ml of nocodazole (Merck) or DMSO for 16 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50 μl of 100 mg/ml of lysozyme (Merck, Germany) was added to each sediment aliquot and incubated overnight at 37°C with gentle mixing ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... and n-butanol (nBuOH) (3 × 100 mL each, Merck, China). The extract of each phase was concentrated in vacuo ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% ß-Mercaptoethanol and 500 units/ml Lyticase (MERCK)) and incubated at 37°C for 2 h ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 mg/ml of fast green (Merck-Sigma-Aldrich) was added to the heparin solution to verify effectiveness of the injection ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 2 μg/ml of recombinant TNC (Merck Millipore) added to the medium ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 ml CaCl2 (2.5 M; Merck; Catalog Cat.nr. 1023820500) and 12 ml of ddH2O were slowly added (5 ml/15 cm plate ...
-
bioRxiv - Neuroscience 2023Quote: ... 20 ng/mL fibroblast growth factor 2 (Merck Millipore), and 10 ng/mL epidermal growth factor (Merck Millipore) ...
-
bioRxiv - Neuroscience 2021Quote: ... 350 µl of a 1:100 dilution of 2-Mercaptoethanol (Merck, 8057400250), 250 µl insulin (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... monolithic amino (Chromolith NH2, 100 × 4.6 mm, 2 µm, 130 Å; Merck) and two zwitterionic functional groups – sulfoalkylbetaine bonded to (IV. ...
-
bioRxiv - Microbiology 2021Quote: ... Parasite nuclei were stained using 5 µg/ml Hoechst (Merck) and Vectashield (Vector Laboratories ...
-
bioRxiv - Immunology 2023Quote: ... Staphylococcus-Enterotoxin-B (SEB) (5 µg/ml, Merck Sigma-Aldrich), DAPI (Merck Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... Sections were incubated with PBS DAPI (5 µg/mL) (Merck) for 20 minutes and mounted using ProLong Diamond antifade mounting medium (Invitrogen).
-
bioRxiv - Biophysics 2024Quote: ... cell were treated with 5 µg/mL Mitomycin C (Merck) for 1 hour ...
-
bioRxiv - Plant Biology 2022Quote: ... on a SeQuant ZIC-pHILIC HPLC column (Merck, 100 × 2.1 mm; 5 μm) and on a C18-column (Waters ...
-
bioRxiv - Biophysics 2023Quote: ... DNA oligomers were purchased with a 5’ Cy3 modification (100, 20 mer: Merck, Germany ...
-
bioRxiv - Developmental Biology 2023Quote: ... 90% and 100% ethanol and 5 min in xylene/ethanol (1:1, Merck) and 5 min in xylene ...
-
bioRxiv - Biochemistry 2023Quote: ... Assays were quenched using 100 μL 5 M H2SO4 (Merck, Rahway, United States). Ethylene and ethane were detected via gas chromatography using the gas chromatograph (GC ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Neuroscience 2024Quote: ... xylene (2 x 5 min) and coverslipped using Entallan mounting medium (Merck). Samples were imaged using an Olympus BX51 microscope equipped with an Olympus DP27 digital camera (Olympus Microscope Solutions).
-
bioRxiv - Biophysics 2021Quote: COS-7 cells were cultured in DMEM containing 4.5 g/l glucose and GlutaMAX™additive (Thermo Fischer Scientific, Waltham, MA, USA) supplemented with 100 U/ml penicillin and 100 μg/ml streptomycin (Merck Millipore,Burlington, MA, USA), 1 mM sodium pyruvate (Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... or N-Butyl phosphate (NBP, mixture of mono-N-Butyl phosphate and di-N-Butyl phosphate) of >95% purity (808555, Merck), were prepared by diluting in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Systems Biology 2022Quote: ... Kinase expression was induced by addition of 200 μM copper sulfate (Merck KGaA, 7758-99-8) in the media ...
-
bioRxiv - Genomics 2021Quote: ... and penicillin and streptomycin (final concentrations 100 units/ml and 100µg/ml, respectively; Merck, Darmstadt, Germany) in tissue culture flasks and plates (TPP ...
-
bioRxiv - Microbiology 2022Quote: ... ampicillin (50 µg mL-1) (Polfa Tarchonin) and cyclocheximide (100 µg mL-1) (Sigma-Aldrich/Merck) were supplemented to the media as selective agents.
-
bioRxiv - Microbiology 2021Quote: ... 50 ml centrifuge tubes containing 5 ml of Tryptic Soy Broth (TSB, Merck KGaA, Darmstadt, Germany) were inoculated with one colony from an overnight culture (see above ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5 U ml−1 penicillin and 50 μg ml−1 streptomycin (Merck Life Science (Sigma)) at 37 °C and 5% CO2 ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by incubation in 10 mL of 2 U/mL dispase solution (D4693; Merck KGaA) at 4 °C overnight ...
-
bioRxiv - Genomics 2019Quote: ... and 100 Units/ml of Recombinant mouse LIF Protein (Merck ESG1107). Culture were seeded at an average density of ∼ 3.8*104 cells/cm2 and passaged every 48 h.
-
bioRxiv - Cancer Biology 2019Quote: ... streptomycin (100 U/ ml) and L-glutamine (4 mM) (Merck, G3126), pH 7.4 ...