Labshake search
Citations for Merck :
1 - 50 of 2587 citations for Locostatin CAS 90719 30 5 100% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... Staining was blocked for 30 min with CT buffer (0.5% Triton X-100, 5% ChemiBLOCKER in 0.1M NaP pH 7, Sigma Aldrich & Merck) at RT ...
-
bioRxiv - Microbiology 2024Quote: ... 30 % DMSO and 100 mM NaOH (Merck®) at pH 11 ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-incubated for 30 minutes in 5% BSA (Merck) in PBS containing 0.05% Tween-20 (PBST) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.04 mM cytosine (Merck/Sigma-Aldrich, CAS number : 71-30-7), 0.04 mM uracil (Merck/Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Systems Biology 2024Quote: ... (5) Pronase (Merck, CAS-No 9036-06-0) at a concentration of 1:100 in E3 1x medium is added at 20 hpf to remove the chorion [83] ...
-
bioRxiv - Neuroscience 2022Quote: ... Following the addition of 30-μl of 100 U/ml thrombin (Merck) in Grey’s BSS to coagulate the plasma by stirring with a pipette tip ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mg/mL Triton X-100 (Merck, X100). Solubilisation was carried at 4 °C for 20 min with mild agitation ...
-
bioRxiv - Neuroscience 2023Quote: ... 100 µl of 5 mg/ml DNase (Merck, 10104159001) and 100 µl of 2.5% trypsin-EDTA (Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 µM fluorescein (46955, CAS 2321-07-5, Merck). The conductivity of 0% NaCl and 100% NaCl was respectively 5.99 µS/cm and 11.02 mS/cm and increased linearly with the NaCl concentration ...
-
bioRxiv - Genetics 2023Quote: ... and CldU 100 μM (5-chloro-2’-deoxyuridine, C6891, MERCK). Cells were embedded in agarose block and DNA was prepared and combed on silanized coverslips ...
-
bioRxiv - Immunology 2020Quote: ... the Protein G chip was regenerated for 30 seconds with 100 mM Glycin-HCl (Merck) pH 1.5 at 30 µL/min and the process was repeated starting a new cycle with the capture of the potentiating antibody ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 100 mM NaCl) using an Amicon® Ultra-15 30 K Centrifuge Filter (Merck Millipore).
-
bioRxiv - Microbiology 2023Quote: ... 1 filter disc (6 mm) impregnated with 5 µM of 30% (v/v) H2O2 (Merck) was placed on the seeded plate ...
-
bioRxiv - Neuroscience 2020Quote: ... Absolute ethanol (CAS Number: 64-17-5) was obtained from Merck KGaA (Darmstadt ...
-
bioRxiv - Neuroscience 2021Quote: ... Absolute ethanol (CAS Number: 64-17-5) was obtained from Merck KGaA (Darmstadt ...
-
bioRxiv - Neuroscience 2021Quote: ... Absolute ethanol (CAS Number: 64-17-5) was obtained from Merck KGaA (Darmstadt ...
-
bioRxiv - Neuroscience 2024Quote: ... Absolute ethanol (CAS Number: 64-17-5) was obtained from Merck KGaA (Darmstadt ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 8.56 mM NaCl (Merck/Sigma-Aldrich, CAS number : 7647-14-5), 18.7 mM NH4Cl (Merck/Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.04 mM guanine (Merck/Sigma-Aldrich, CAS number : 73-40-5), 0.04 mM thymidine (Merck/Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.04 mM adenine (Merck/Sigma-Aldrich, CAS number : 73-24-5), 0.04 mM cytosine (Merck/Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.04 mM thymidine (Merck/Sigma-Aldrich, CAS number : 50-89-5).
-
bioRxiv - Biochemistry 2023Quote: ... 100 μM phenylmethylsulfonyl fluoride) with ∼ 5 mg of DNAseI (Merck, #10104159001) and ∼ 5 mg of lysozyme (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2021Quote: ... 30 kDa (idem, UFC903024), 50 kDa (idem, UFC905024), 100 kDa (idem, UFC910024) and 300 kDa (Merck, Vivaspin 20 centrifugal concentrator ...
-
bioRxiv - Microbiology 2023Quote: ... 30 mL of the resulting supernatants were concentrated using 100 kDa Amicon filters (Merck Millipore, Ireland), to ≤ 1 mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... reduced with 5 mM TCEP for 30 min and alkylated with 10 mM iodoacetamide (Merck, I1149) for 30 min ...
-
bioRxiv - Genetics 2024Quote: ... Membranes were blocked for a minimum of 30 min in 5% Skim Milk Powder (Merck, #70166) in PBS + 0.1% Tween-20 (PBS-T ...
-
bioRxiv - Cell Biology 2022Quote: ... low-viscous glycerol (glycerol for fluorescence microscopy; CAS 56-81-5; Merck) was spun on a plasma-cleaned glass coverslip and then sandwiched with the plasma-cleaned PDMS sheet ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.4 mM L-isoleucine (Merck/Sigma-Aldrich, CAS number : 73-32-5), 0.8 mM L-leucine (Merck/Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.4 mM L-threonine (Merck/Sigma-Aldrich, CAS number : 72-19-5), 0.1 mM L-tryptophan (Merck/Sigma-Aldrich ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.8 mM L-leucine (Merck/Sigma-Aldrich, CAS number : 61-90-5), 0.5 mM L-lysine (Merck/Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 µM S-(5′-adenosyl)-L-methionine chloride dihydrochloride (SAM, Merck, A7007) used as a primary methyl donor molecule ...
-
bioRxiv - Molecular Biology 2022Quote: ... A SeQuant ZIC-pHILIC (2.1×100 mm, 5-μm particle) column (Merck) used for chromatographic separation ...
-
bioRxiv - Immunology 2024Quote: ... permeabilized for 5 min using 0.1% vol/vol Triton X-100 (Merck), and blocked using 5% vol/vol FCS ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mM MgCl2) using Amicon Ultra-0.5 mL Centrifugal Filters (30 or 100 K MWCO, Merck Millipore). After re-measuring the concentrations by densitometry ...
-
bioRxiv - Microbiology 2020Quote: ... dehydrated in gradual ethanol (30–100%) and propylene oxide followed by embedding in Epon (Merck, Darmstadt, Germany). Semithin sections were stained with toluidine blue ...
-
bioRxiv - Microbiology 2023Quote: ... diluted 1 : 100 in 1 × PBS buffer (pH 7.5) with 0.1 % hydrogen peroxide (stock concentration 30 %, Merck) and 2 mM ATP (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... (+/-)-Abscisic acid (ABA, CAS No:14375-45-2), and Gibberellic acid (GA3, CAS No: 77-06-5) were purchased from Merck KGaA/ Sigma-Aldrich (Darmstadt ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... NMDA (1 µM, 10 µM or 20 µM, Merck, CAS 6384-92-5) was washed in through the perfusion system and the change of Ihold ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Genetics 2024Quote: ... 90%, 100% ethanol, 5 min each), cleared in xylene (twice, 5 min each) and mounted with DPX mounting medium (Merck).
-
bioRxiv - Cancer Biology 2023Quote: ... cell culture supernatant was concentrated using Amicon filter columns with either 30 kDa or 100 kDa cutoff (Merck), retaining glycodelin in the concentrated part ...
-
bioRxiv - Biochemistry 2023Quote: ... at 4 °C for 30 s and concentrated in a 100 kDa Amicon Ultra centrifugal filter (Merck Millipore), which was equilibrated with 1% GDN in IP buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... and plates were developed in n-hexane/diethylether/acetic acid 70:30:5 (v/v/v) (Merck, Roth) in a developing chamber (CAMAG ...
-
bioRxiv - Cancer Biology 2024Quote: ... T865.3) was followed by 5 minutes of rinsing with water and 20-30 seconds of Eosin solution (Merck, 115935 ...
-
bioRxiv - Biophysics 2023Quote: ... DNA oligomers were purchased with a 5’ Cy3 modification (100, 20 mer: Merck, Germany ...
-
bioRxiv - Plant Biology 2022Quote: ... on a SeQuant ZIC-pHILIC HPLC column (Merck, 100 × 2.1 mm; 5 μm) and on a C18-column (Waters ...
-
bioRxiv - Biochemistry 2023Quote: ... Assays were quenched using 100 μL 5 M H2SO4 (Merck, Rahway, United States). Ethylene and ethane were detected via gas chromatography using the gas chromatograph (GC ...
-
bioRxiv - Developmental Biology 2023Quote: ... 90% and 100% ethanol and 5 min in xylene/ethanol (1:1, Merck) and 5 min in xylene ...