Labshake search
Citations for Merck :
301 - 350 of 1459 citations for Integrin alpha 5 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... rabbit anti-IDH2 (1:100, Merck, HPA007831), mouse anti-Tom20 (1:100 ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit polyclonal anti-HA-tag (#H6908, Merck), rabbit polyclonal anti-RNF213 (#HPA003347 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5G-H: Rabbit anti-Olig2 (Merck, AB9610), sheep anti-TGM2 (Novus Biologicals ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit Anti-Neurofilament 200 antibody (Merck, #N4142), rabbit Anti-BetaIII-Tubulin antibody (Abcam ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-pH3 (1/1000, Merck Millipore), goat anti-DCX (1/1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit-Neurogranin (1:500, AB5620, Merck Millipore), mouse-Parvalbumin (1:200 ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit-Calbindin (1:500, AB1778, Merck Millipore), goat-Calbindin (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or a rabbit IgG control (Merck Millipore) and used for IP as per manufacturer instructions (Invitrogen).
-
bioRxiv - Plant Biology 2020Quote: ... or anti-rabbit peroxidase-conjugated (Merck Millipore) or alkaline phosphatase-conjugated antibodies (Jackson Immuno Research ...
-
bioRxiv - Cancer Biology 2019Quote: ... or anti-rabbit IgG control (Merck; PP64). qPCR primers used to amplify SOX10 bound genomic sequences are shown in Supplemental Table 1.
-
bioRxiv - Genetics 2020Quote: ... SLN (1:1000, rabbit, ABT13, Merck Millipore), MyHC II (1:200 ...
-
bioRxiv - Molecular Biology 2020Quote: ... rabbit polyclonal GluA1 (WB, ab1504; Merck Millipore), mouse monoclonal GluA1 (IF ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-NKX6.1 (1:200, HPA036774, Merck), mouse anti-TUJ1 (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-MAP2 (1:1,000, Merck, #AB5622), Alexa Fluor 568-conjugated goat anti-chicken IgG (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... and PLA Probe Anti-Rabbit MINUS (Merck) diluted 1:10 and reacted at 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-Aquaporin IV (AB2218, Merck Millipore), GFAP-Cy3 (C2905 ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-NG2 Chondroitin Sulfate Proteoglycan (Merck), mouse anti-AXL (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-synapsin (ab1543P, 1:1000, Merck), mouse anti-bassoon (clone SAP7F407 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and rabbit anti-FANCJ (cat. B1310, Merck). Specific probes that cross-react with the primary antibodies were used for rolling circle amplification and the related SiRF signals were visualized as discrete PLA (proximity ligation assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... or normal rabbit IgG (#12-370, Merck) antibody were pre-incubated with washed Dynabeads (#10001D ...
-
bioRxiv - Molecular Biology 2023Quote: ... or normal rabbit IgG (#12-370, Merck) antibody at 4°C with rotation ...
-
bioRxiv - Genomics 2023Quote: ... rabbit anti-PKD1L2 (1:1000; Merck Millipore); mouse anti-GFAP (1:1000 ...
-
bioRxiv - Bioengineering 2023Quote: ... rabbit anti-M-opsin (1:300, Merck) for detection of native M-Opsin in cones and activated M-Opsin in rods ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-parvalbumin (1:5,000; PC255L, Merck) and rabbit anti-somatostatin (1:5,000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and rabbit IgG polyclonal antibody (Merck, #PP64) as negative control ...
-
bioRxiv - Biophysics 2022Quote: ... Polyclonal rabbit-anti-GFP antibody (AB3080, Merck) was used to amplify the GFP signal ...
-
bioRxiv - Cell Biology 2023Quote: ... and goat anti-rabbit IgG-HRP (Merck, cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions containing the respective recombinant proteins were pooled and concentrated using Amicon® Ultra-15 spin concentrators with 10 kDa cut-off (Merck Millipore). Concentrated protein pools were run on a Superdex 200 Increase 10/300 GL ...
-
bioRxiv - Immunology 2020Quote: ... urinary human menopausal gonadotropin (hMG) (HMG-lepori 75 UI, Angelini Farmacéutica, S.A, Spain) and recombinant hCG (Ovitrelle 250 micrograms, Merck Serono Europe Limited, Spain) or luprorelin acetate (Procrin 1 mg/0,2 ml ...
-
bioRxiv - Biochemistry 2022Quote: ... Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin, Bovine Serum, 12659, Merck Millipore) powder solved in 1 × TBST ...
-
bioRxiv - Microbiology 2019Quote: ... The pellet was dissolved in three ul distilled water and spotted onto 5×5 cm silica gel plates (Merck) using automatic TLC sampler ...
-
bioRxiv - Developmental Biology 2021Quote: ... The HPLC was equipped with a hydrophilic ZIC-pHILIC column (150 × 2.1 mm, 5 μm) with a ZIC-pHILIC guard column (20 × 2.1 mm, 5 μm, Merck Sequant). 5ul of each sample was used for each assay ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Microbiology 2022Quote: ... were washed with RPMI 2%G by applying 5 psi perfusion for 5 min using the CellASIC® ONIX2 microfluidic system (version 1.0.4 Millipore Merck). Yeasts were loaded into the CellASIC culture chambers by applying 8 psi for 5 s twice (Thomson et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were incubated with Prussian’s blue solution containing ferrocyanide acid solutions (5% Hydrochloric acid (HCl) and 5% potassium ferrocyanide (Merck)) at a 1:1 ratio for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5 ml conditioned medium was centrifuged (5 min, 500g) and filtered through Amicon Ultra-0.5 Centrifugal Filter unit (Merck). Ammonia in TIFs and SCFs was then quantified using Dimension Ammonia assay (Siemens ...
-
bioRxiv - Bioengineering 2021Quote: ... the chemically decellularized aortas were treated with 900 units (25 μg/mL DNase I recombinant, RNase free, Cat. No. 4716728001, Roche, Merck KGaA, Darmstadt, Germany) using a total of 3 DNase treatment for 2 hours each to achieve the desired level of DNA assessed by (Quant-iT™ PicoGreen™ dsDNA Assay Kit ...
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Neuroscience 2023Quote: ... after testing multiple antibodies (anti-NeuN rabbit Antibody, ABN78 & ABN78C3, Merck; anti-NeuN rabbit Antibody, ab177487, Abcam; anti-NeuN mouse Antibody, MAB377, Merck) and increasing antibody concentrations (up to 1:50) ...
-
bioRxiv - Genetics 2023Quote: ... membranes were incubated with an anti-sera peptide based polyclonal rabbit GLK2-antibody (1:3,000) and a peroxidase-conjugated anti-rabbit antibody (1:10,000) (Merck, Darmstadt, Germany) for 1 h at room temperature in TBST [Tris-HCl 20 mM (pH 7.6) ...
-
bioRxiv - Microbiology 2022Quote: ... was prepared using 5× M9 minimal salts (Merck), diluted as appropriate ...
-
bioRxiv - Microbiology 2019Quote: ... For experiments using 5-FAM-rifampicin (Merck-Millipore), MLP or persistence phase cells were exposed to 1.5 µg/ml (concentration equimolar to 10x MBC rifampicin ...