Labshake search
Citations for Merck :
51 - 100 of 4013 citations for Indeno 1 2 3 Cd Pyrene D12 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay was used to analyze the cell viability of SH-SY5Y cells ...
-
bioRxiv - Bioengineering 2023Quote: ... 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was purchased from Merck (Germany). The U-87 cell line was a kind gift from Esendagli Group at Hacettepe University (Turkey) ...
-
bioRxiv - Microbiology 2023Quote: ... 2–3 mL of stock solution was applied onto preparative TLC plates (glass, Merck, 20×20 cm ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2020Quote: ... and 25 µL of a 10 vol% solution of tetraethyl orthosilica (TEOS, reagent grade, 98%) in ethanol (absolute, Merck) 60 ...
-
bioRxiv - Systems Biology 2022Quote: ... [13C3] glycerol (12.5%) (Purchased from CK Isotopes, 99% purity) and [15N1] NH4Cl (20%) (Purchased from Merck, 98% atom purity) were the carbon and nitrogen isotopically labelled substrates in the media ...
-
bioRxiv - Systems Biology 2023Quote: ... after adding 1 mL of chloroform:methanol 2:1 (v:v) (Merck), the sample was vortexed at 1200 rpm for 1 h at room temperature ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Immunology 2023Quote: ... or 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck).
-
bioRxiv - Cell Biology 2022Quote: ... 20 × 2.1 mm and a 2 min gradient from 10% to 98% aqueous MeCN with 0.1% FA (H2O: Carl Roth GmbH + Co. KG ROTISOLV® Ultra LC-MS; MeCN: Merck KGaA LiChrosolv® Acetonitrile hypergrade for LC-MS ...
-
bioRxiv - Biophysics 2021Quote: ... This mix included 98% unlabeled recombinant human E254N tubulin diluted in assay buffer containing oxygen scavengers (180 mg/ml catalase (C40, Merck) and 752 mg/ml glucose oxidase (22778.01 ...
-
bioRxiv - Biophysics 2022Quote: ... dimethyl sulfoxide (DMSO, Molecular Biology grade), chlorpromazine hydrochloride (CPZ, ≥ 98% TLC) and fluvoxamine maleate (FLUV, ≥ 97% HPLC) were purchased from Merck.
-
bioRxiv - Microbiology 2023Quote: ... tricornutum PT15 Xenic Minus nitrate (0 µM) 100 µL of an aqueous 15N- L-valine-solution (98 atom % 15N, Merck, Saint Louis ...
-
bioRxiv - Microbiology 2021Quote: ... Mycelia cultured for 24 h in CD medium were collected by filtering through Miracloth (Merck Millipore, Darmstadt, Germany), washed with water ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to adding the cells.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... excess media was removed from wells and mf were incubated with 0.5 mg/ml MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Merck) in PBS at 37°C for 90 min ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Molecular Biology 2019Quote: Inflorescences were harvested into fresh fixative (3:1 96% ethanol (Merck) and glacial acetic acid ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% penicillin-streptomycin and 0.00035% 2-mercaptoethanol (Merck)) to an orbital shaker ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of 1 M DTT (Merck, D9779) was added and the sample was heated for 10 min at 70°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... the MEK1/2 inhibitor PD0325901 (1 μM, Merck), LDN-193189 (100 nM ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 mL of chloroform:isopropanol 2:1 (v:v)(Merck) were used to elute the neutral lipid fraction (NL) ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Systems Biology 2022Quote: ... 70 kDa FITC-dextran and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) were purchased from Merck Life Science UK Ltd. ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Microbiology 2023Quote: ... and matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) mass spectrometry (MS) and circular dichroism (CD) spectroscopy analyses were of HPLC reagent grade and purchased from Merck KGaA (Darmstadt ...
-
bioRxiv - Cell Biology 2023Quote: Proteins were extracted from 50 hpf zebrafish embryos using the lysis buffer from the calpain 1/2 activity kit (InnoZyme™ Calpain 1/2 Activity Assay Kit CBA054 purchased from Merck Millipore). Protein concentration was adjusted to 2 mg/mL and calpain enzymatic activity was measured in microtubes following the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Pathology 2023Quote: ... 1 µl of CAA (400mM 2-Chloroacetamide (#C0267, Merck) was added ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...