Labshake search
Citations for Merck :
101 - 150 of 1219 citations for Human Urocortin 3 UCN3 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Normal human epidermal keratinocytes were obtained from Merck. All lines were maintained in 3:1 DMEM (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... growth in LB and human serum (Merck #H4522) was measured ...
-
bioRxiv - Immunology 2023Quote: Concentrations of cytokines in supernatants of T cell cultures were assessed with the MILLIPLEX MAP Human Th17 magnetic bead panel kit (Merck Millipore, Burlington, MA, USA) and the Luminex® 200™ system according to the guidelines of the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... R&D, AF2408), Goat-Anti Human SOX17 (1:100, R&D, AF1924) or Mouse Anti-Human Beta-Tubulin (1:1000, Merck, T8660) primary Chicken Anti-Human MAP2 (1:2000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... stained with anti-human IFN-γ and anti-human IL2 antibodies for 40 min at RT in 0.2% saponin (Merck, Germany) in PBS (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... was washed 3 times with PBS (Merck Millipore ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 10% human serum AB (Merck Sigma-Aldrich), 300 IU/ml IL-2 ...
-
bioRxiv - Immunology 2021Quote: ... anti-human Caspase-1 antibody (06-503, Merck Millipore); anti-mouse IL-1β antibody (5129-100 ...
-
bioRxiv - Biophysics 2021Quote: ... Human pancreatic beta cells 1.4E7 were purchased from Merck and cultured in RPMI-1640 medium (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... conidia were opsonized with normal human serum (Merck Millipore). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... human mitochondria (clone 113-1, Merck Millipore, 1:100), and BrdU (clone BU1/75 ICR1 ...
-
bioRxiv - Cell Biology 2022Quote: ... 20 ng/ml human EGF (Merck, Cat Number: E9644), 0.5 mg/ml hydrocortisone (Merck ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μg/mL mouse anti-human TGN46 (SAB4200355, Merck), or a 1 in 20 dilution of rat anti-β-tubulin (clone YL1/2 ...
-
bioRxiv - Biophysics 2021Quote: Rabbit polyclonal anti human IRSp53 (07-786 – Merck Millipore), mouse monoclonal anti CA (24.2 – NIH AIDS Reagent Program – FisherBioServices) ...
-
bioRxiv - Biophysics 2021Quote: ... rabbit polyclonal anti human IRSp53 (07-786 – Merck Millipore), mouse anti CA (183H125C – NIH3537) ...
-
bioRxiv - Molecular Biology 2021Quote: Caco-2 cell line human colon adenocarcinoma (Merck, UK) were cultivated in DMEM (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: The human immortal chondrocyte cell line – C28/I2 (Merck) was used in this study ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 mg/mL Human recombinant Insulin (Merck, Cat. #91077C) and 1% Pen/Strep ...
-
bioRxiv - Neuroscience 2023Quote: ... Tau ladder (six human tau recombinant isoforms, Sigma-Merck) was used to identify tau isoforms in NCI-H716 cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1.2 IU/ml human chorionic gonadotropin (HCG) (C1063, Merck), 25 µg/ml sodium pyruvate and penicillin-streptomycin ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µg/ml of IgG from human serum (Merck) in PBS were added to all blocking and antibody incubations ...
-
bioRxiv - Cell Biology 2023Quote: ... were coated with human plasma fibronectin (Merck Millipore FC010) at a concentration of 5 µg/cm2 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 0.1 IU/ml recombinant human FSH (Merck & Co., Inc), 0.125 mg/ml recombinant human hyaluronan (Novozymes) ...
-
bioRxiv - Cell Biology 2022Quote: ... HRP-conjugated goat anti-human IgG (AP309P, Merck KGaA). For stripping and re-probing of Western blot membranes ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-human nuclei (HuNu; 1:100; MAB4383, Merck Millipore), and anti-E-cadherin-1 (ECAD ...
-
bioRxiv - Microbiology 2024Quote: ... the bacterial suspension and human serum (Merck, Darmstadt, Germany) were mixed in a 1:1 ratio (100 µL each) ...
-
bioRxiv - Cell Biology 2024Quote: ... 50nM Mission esiRNA against human PTGER2 or PTGER4 (Merck). 50nM non-targeting Silencer™ Negative Control #1 siRNA (Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...