Labshake search
Citations for Merck :
1 - 50 of 6163 citations for Ethyl 4 acetyl 1 cyclopropyl 2 5 dimethyl 1H pyrrole 3 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 2-heptyl-3- hydroxy-4(1H)-quinolone (PQS) (Sigma Aldrich, Merck Life Science ...
-
bioRxiv - Bioengineering 2023Quote: Pyrrole (C4H5N) 98.0% (Merck, Germany) was vacuum distilled before use ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... namely using 1 g/L MS-222 (Ethyl 3-aminobenzoate methanesulfonate, Merck #E10521) and subsequent exsanguination by cutting the gill arches ...
-
bioRxiv - Cell Biology 2024Quote: ... MRS 2211 (2-[(2-chloro-5-nitrophenyl)azo]-5-hydroxy-6- methyl-3-[(phosphonooxy)methyl]-4-pyridinecarboxaldehyde disodium salt and MRS 2395 (2,2-dimethyl-propionic acid 3-(2-chloro-6-methylaminopurin-9- yl)-2-(2,2-dimethyl- propionyloxymethyl)-propyl ester) were obtained from Merck (Darmstadt, Germany).
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Biochemistry 2024Quote: ... a volume of 1H,1H,2H,2H-perfluoro-1-octanol (PFO, Merck) is added to the emulsion with gentle pipetting used to break the emulsion ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.625 mM TBTA (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine) (Merck Millipore), and 6.25 mM CuSO4 (Merck Millipore) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 500 μL 1H,1H,2H,2H-perfluoro-1-octanol (Cat#370533-25G, Merck) was added into the emulsions and mixed gently until droplets were all de-emulsified ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... from Panreac Applichem ITW Reagents (Darmstadt, Germany), dimethyl sulfoxide (DMSO) (anhydrous, ≥ 99.9%) and ethyl acetate (EtOAc) (Food grade, ≥ 99%) from Merck (Darmstadt, Germany), and ultra-pure water was obtained through a Milli-Q system (Merck Millipore ...
-
bioRxiv - Bioengineering 2024Quote: ... 1% (v/v) dimethyl sulfoxide (D2650, Merck), 0.1 mM 2-mercaptoethanol (198-15781 ...
-
bioRxiv - Biochemistry 2023Quote: ... the cells were discarded and N-ethyl-maleimide (Merck, 2 mM) and Pefabloc (Roth ...
-
bioRxiv - Biophysics 2021Quote: ... Fusion was induced by surfactant replacement with 1H,1H,2H,2H-Perfluoro-1-octanol (Merck) (PFO) ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Neuroscience 2023Quote: ... at 1/1000 dilution or Laurdan (#40227, 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine, Merck, Sigma-Aldrich) at 1/500 dilution for 30 min at 37°C in the dark ...
-
bioRxiv - Bioengineering 2024Quote: ... the emulsion was destabilized by adding the surfactant 1H,1H,2H,2H-Perfluoro-1-octanol (Merck) on top of the buffer ...
-
bioRxiv - Developmental Biology 2023Quote: ... Product number E4250) (1 mg/ml) to contract pigment cells alongside 0.01% Tricaine (Ethyl 3-aminobenzoate methanesulfonate, Sigma-Aldrich (Merck) Product number E10521 ...
-
bioRxiv - Biochemistry 2024Quote: ... ROS quenching was carried out by treating cells with 5 mM N-acetyl cysteine (NAC) (616-91-1, Merck) for 1 h.
-
bioRxiv - Developmental Biology 2022Quote: ... the channels where coated/treated with 1% (v/v) Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 (Fluorochem ...
-
bioRxiv - Developmental Biology 2020Quote: ... The gels were subsequently demulsified with 45 µl 1H,1H,2H,2H Perfluoro 1 octanol (PFO) (Merck, #370533) into 200μl of MM+ Ri medium ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with 5 µM 4′,6-diamidino-2-phenylindole (DAPI) (Merck) in PBS if required ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Biochemistry 2020Quote: ... ethyl acetate p.a (Merck), KBr Pro spectrophotometry ...
-
bioRxiv - Immunology 2022Quote: [12C4]-ethyl acetoacetate (Merck) and [13C4]-ethyl-acetoacetate (Cambridge Isotope labs ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 mL of chloroform:isopropanol 2:1 (v:v)(Merck) were used to elute the neutral lipid fraction (NL) ...
-
bioRxiv - Immunology 2024Quote: ... Dimethyl 2-oxoglutarate (DM-OG) was purchased from Merck (cat no: 349631-5G) and added to the culture medium at 2mM and 4mM final concentrations.
-
bioRxiv - Microbiology 2024Quote: ... The chromatic mutants were mixed in different ratios (1:1, 1:3, 3:1) and the mixtures were fixed using 4% paraformaldehyde (Sigma−Aldrich/Merck, Germany) for 4 h at 4°C.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... determined by means of quantitative NMR using TraceCERT® ethyl 4-(dimethylamino)benzoate from Merck as an internal calibrant [48 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1-oleoyl-2-acetyl-sn-glycerol (OAG) and 4α-phorbol 12,13-didecanoate (4α-PDD) were obtained from Merck (Gillingham, UK). Sphingosine-1-phosphate (S1P ...
-
bioRxiv - Cell Biology 2021Quote: ... Surfaces were functionalised by flooding the device with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500™ (3M™) ...
-
bioRxiv - Biochemistry 2024Quote: ... Diener Electronic) followed by channel surface functionalization using 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl) silane (Merck) in HFE-7500™ (3M™ Novec™).
-
bioRxiv - Bioengineering 2024Quote: ... We then dissolved 100 μmol of N-ethyl-N’-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Merck, E7750) in 1 mL of MES buffer and added it to the beaker ...
-
bioRxiv - Microbiology 2024Quote: ... and 300 nM 4′,6′-diamidino-2-phenylindole (DAPI) (Merck, Germany; #28718-90-3). Fluorescence signals were observed by an ECLIPSE TE2000-U fluorescence microscope (Nikon ...
-
bioRxiv - Microbiology 2023Quote: ... Hydrophobic surface treatment was performed after bonding by flushing with 1% (v/v) trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Merck) in HFE-7500 and ...
-
bioRxiv - Microbiology 2023Quote: ... dimethyl sulfoxide (DMSO) (Merck), dimethylacetamide (DMAc ...
-
bioRxiv - Cell Biology 2021Quote: ... Differentiation of 4D7 and 2M12 cells was induced by 2% dimethyl sulfoxide (DMSO; Merck) for 48 hr ...
-
bioRxiv - Developmental Biology 2024Quote: ... the sample were incubated in ethyl cinnamate for 4 hours at room temperature (112372-100G, Merck).
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2022Quote: ... N-acetyl cysteine (A7250, Merck) was prepared in water.
-
bioRxiv - Developmental Biology 2022Quote: ... by submersion in 160 mg/l MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich, Merck, Darmstadt, Germany) dissolved in tank water ...
-
bioRxiv - Plant Biology 2023Quote: Plants were grown on 1/2 MS agar plates containing 0.01% (v/v) dimethyl sulfoxide (mock) or 50 ng mL-1 TM (654380; Merck, Darmstadt, Germany) for 14 days ...
-
bioRxiv - Neuroscience 2023Quote: ... with a stock solution of gramicidin A (4 mg/ml - dissolved in dimethyl sulfoxide, DMSO, Merck) to achieve a final concentration of 80 μg/mL gramicidin19 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI, Merck) was added for nuclear staining and incubated at room temperature for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... dimethyl sulfoxide (DMSO, Merck, 99.9%), phosphate buffered solution standard tablets (PBS ...