Labshake search
Citations for Merck :
251 - 300 of 4036 citations for Ciprofloxacin Hcl 100 Ug Ml In Methanol 2 3 Carboxyl 13C3 99%; Quinoline 15N 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... Smears were methanol fixed and stained with Giemsa (Merck Millipore) before blinded assessment of the number of merozoites by light microscopy (20 individual schizonts) ...
-
bioRxiv - Biochemistry 2023Quote: ... sodium azide (Na3N) and methanol (MeOH) were purchased from Merck. All the chemicals were used without any further purification ...
-
bioRxiv - Cancer Biology 2024Quote: ACN and methanol (MeOH) were purchased from Merck (Darmstadt, Germany). MilliQ water (Millipore ...
-
bioRxiv - Molecular Biology 2023Quote: ... methanol and Acetonitrile LC-MS grade were obtained from Merck. Formic acid Ammonium formate and Perchloric acid were also purchased from Merck ...
-
bioRxiv - Plant Biology 2024Quote: ... HPLC-grade methanol (MeOH) was purchased from Merck (Darmstadt, Germany). MilliQ water (Millipore ...
-
bioRxiv - Developmental Biology 2024Quote: ... 50% and 75% methanol diluted in 0.1% tween-20 (Merck) PBS solution and kept in 100% methanol (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... Fixation of cells with 250 µL methanol (Merck, Darmstadt, Germany) for 15 min and subsequent air-drying for 10 min followed ...
-
bioRxiv - Biochemistry 2022Quote: ... and hydrogen chloride (HCl) by Merck (Darmstadt, Germany), sodium azide (NaN3 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with 2M-HCl (Merck,USA), washed with PBS-0,5%Tween20-0,05%BSA (Sigma-Aldrich,USA) ...
-
bioRxiv - Microbiology 2024Quote: ... 10 mM Tris-HCl pH 8.0 (Merck, USA), and 1% SDS (Nacalai Tesque ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clones were trial-screened for positive PCR products by making mirror plates and subjecting one of the plates to cell lysis (50mM Tris-HCl pH 8, 1mM EDTA, 0.5% Tween-20, 50-80 μg/ml Proteinase K Merck-3115801001) at 37°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... after centrifugation the cell pellet was resuspended in 0.1 M HCL solution containing 0.5 mg/ml of the protease pepsin (Merck Life science) and left for 20 min at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-Sox9 (Merck, AB5535; 2 μg/ml); anti-Tfap2a (DSHB ...
-
bioRxiv - Immunology 2021Quote: ... and 2 µg/mL TPCK trypsin (Merck). The pfu were counted following staining with 1 % (w/v ...
-
bioRxiv - Immunology 2021Quote: ... with 10 uL/mL 2-ME (Merck) after which RNA was isolated using RNeasy Microprep ...
-
bioRxiv - Genomics 2022Quote: ... and 2 kU/mL DNase I (Merck)] at 37 °C for 60 minutes ...
-
bioRxiv - Genomics 2022Quote: ... and 2 kU/mL DNase I (Merck)] at 37 °C for 60 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U/mL PK-LD (Merck #P0294), 2 mM GlcNAc and 1 mM ATP ...
-
bioRxiv - Immunology 2023Quote: ... containing 10 µg/mL 2-mercaptoethanol (Merck). For increasing bacterial dose analysis ...
-
bioRxiv - Immunology 2021Quote: ... 100 U/ml Penicillin (Sigma-Aldrich; Merck KGaA), 100 μg/ml Streptomycin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... 100 μg/ml Streptomycin (Sigma-Aldrich; Merck KGaA), 2 mM L-Glutamine (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... containing 100 µg/ml ampicillin (Merck, Darmstadt, Germany) overnight at 37°C in a shaking incubator ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 U/mL penicillin/streptomycin (Merck, cat #P4333), sodium pyruvate (Merck ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Molecular Biology 2023Quote: ... using reaction buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl) supplemented with 0.5 mM NADPH (Merck, Rahway, NJ, USA/Sigma-Aldrich) and 0.01-0.02 mg/mL enzyme ...
-
bioRxiv - Biochemistry 2021Quote: ... Centrifugal filters (0.5 mL, 3 k) were purchased from Merck KGaA (Darmstadt ...
-
bioRxiv - Microbiology 2019Quote: ... and 25 U/mL of benzonase (Merck-Millipore, 70664-3)] ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mg/mL (∼40 µM) using Amicon 10K concentrators (Merck) and stored at -80°C till use.
-
bioRxiv - Genetics 2023Quote: ... and CldU 100 μM (5-chloro-2’-deoxyuridine, C6891, MERCK). Cells were embedded in agarose block and DNA was prepared and combed on silanized coverslips ...
-
bioRxiv - Neuroscience 2023Quote: ... rats were anesthetized and underwent transcardial perfusion with 100 mL of saline followed by 100 mL of 4% paraformaldehyde (Merck, Germany) at 72 h following ICH induction ...
-
bioRxiv - Cell Biology 2020Quote: ... or rabbit anti-p34-Arc/ARPC2 (Arp2/3, 1:100, Merck, 07-227). This was followed by incubation with appropriate Alexa Fluor-conjugated secondary antibodies (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... they were incubated in 100 μg/mL DNAse 1 (1 mg/mL, Merck) in a concentration of 1000 cells/μL for 15 mins at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... the wells were rinsed 3 times with PBS and covered with 100 μL 0.5% (v/v) Triton-X 100 (Merck, 1.08603.1000) in PBS for 5 minutes to permeabilize cells ...
-
bioRxiv - Bioengineering 2019Quote: ... The supernatant was passed through the cartridges (pre-conditioned with 5 mL each of tert-methyl butyl ether, methanol (Merck; laboratory grade purity) and deionised water ...
-
bioRxiv - Microbiology 2020Quote: ... the HA-GlmS line was transfected with the pHGBrHrBl-1/2 construct in order to episomally express cytosolic GFP then selected for using 5 μg/mL blasticidin-S-deaminase HCl (Merck Millipore). To generate Pfcerli2SLI-TGD ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HPLC-grade methanol and acetonitrile were obtained from Merck (Darmstadt, Germany), and ultrapure water was supplied by a Milli-Q water purification apparatus (Millipore Lda ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Methanol and diethyl ether used as solvents were obtained from Merck.
-
bioRxiv - Evolutionary Biology 2021Quote: ... The derivatization reaction was terminated with 50 μl of methanol (Merck) with 30 s vortex mixing ...
-
bioRxiv - Cell Biology 2023Quote: ... in PBS at room temperature or ice-cold methanol (Merck Millipore) for 10min on ice ...
-
bioRxiv - Cancer Biology 2023Quote: ... The colonies were fixed for 10 min with methanol (Merck, 1.06009) and stained with 0.5% (w/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were transferred to a methanol pre-activated membrane (Merck, IPFL00010) and then blocked with 5% BSA (ThermoFisher ...
-
bioRxiv - Biochemistry 2022Quote: ... ethanol (EtOH) and methanol (MeOH) were purchased from Merck (Darmstadt, Germany). C8 and C18 reverse-phase medium were purchased from Agela Technologies (Tianjin ...
-
bioRxiv - Neuroscience 2019Quote: ... agarose gel was incubated in 0.25 M HCl (Merck) for 10 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... 800 mM guanidine HCl (#G3272, Sigma-Aldrich now Merck), 2 mM CaCl2 and 0.5 % Triton X-100 ...
-
bioRxiv - Bioengineering 2023Quote: ... Fractions 7 to 10 which were subsequently identified as the particle fractions (PF) were pooled to a volume of 2 ml and concentrated using an Amicon Ultra 100 kDa centrifugal filter (Merck Millipore, MA, USA), made from regenerated cellulose ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mg/mL Triton X-100 (Merck, X100). Solubilisation was carried at 4 °C for 20 min with mild agitation ...
-
bioRxiv - Biochemistry 2021Quote: ... and 100 µg/mL streptomycin (Merck, Massachusetts, United States).
-
bioRxiv - Genetics 2019Quote: Nocodazole (100 ng/ml; Calbiochem, Merck Millipore, Darmstadt, Germany) was used to treat 293FT and HCT116 cells for 3 h ...