Labshake search
Citations for Merck :
201 - 250 of 1216 citations for Caspase 3 p12 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... were incubated for 2 h at room temperature with the respective recombinant glycosyltransferase enzymes (6.3 µg/ mL) and UDP-GlcNAc (2 mM, Merck) in glycosylation buffer (15 mM HEPES ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2019Quote: ... Membranes were blocked with 5% milk in Tris buffered saline (TBS) and probed with antibodies to HCMV IE1 and IE2 (Merck Millipore; MAB-8131; 1/5000), pp52 (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Neuroscience 2021Quote: ... and Pellet Paint Co-precipitant (Merck Millipore #69049-3). Genomic DNA traces were removed with DNA-free DNase Treatment and Removal Reagents (FisherScientific #AM1906 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Bioengineering 2019Quote: ... molecular weight cut-off 3 kDa (Amicon®, Merck) to a concentration of 1 mg/mL as determined by Qubit Protein Assay Kit (Invitrogen™ ...
-
bioRxiv - Biochemistry 2020Quote: ... using 3 kDa MWCO Amicon centrifugal filters (Merck Millipore). For protein denaturation ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Molecular Biology 2023Quote: ... the anti-S tag antibody (Merck, Cat# 71549-3) was added directly to the medium of each well resulting in a final dilution of 1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated with Benzonase Nuclease (Merck Millipore, US170664-3) for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 3-HA were purchased from Merck (Sigma-Aldrich). For L-kynurenine and kynurenic acid ...
-
bioRxiv - Genomics 2022Quote: ... and subsequently blocked in 3% BSA (A8022, Sigma/Merck) in 1x PBS-Tween (137 mM NaCl ...
-
bioRxiv - Plant Biology 2023Quote: ... using a 3 kDa MWCO Amicon centrifugal concentrator (Merck) and the N-terminal His6-tag cleaved with Human Rhinovirus 3C protease at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 × 3 min Neo-Clear (Cat. No. 1.09843, Merck), 2 × 3 min 100% ethanol ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Biochemistry 2020Quote: ... The recombinant protein was dialyzed overnight using an Amicon Ultra 15 mL spin dialysis column 10 000 MWCO (Merck, Germany). Purified protein was quantified using Bradford’s assay ...
-
bioRxiv - Cancer Biology 2021Quote: Primary HPMECs in EBM2 medium or ST1.6R cells in DMEM/1% FBS were cultured overnight and stimulated with 2 μg/ml of recombinant TNC (Merck Millipore) for 24 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... 500 μg/mL rice-derived recombinant human albumin and 213 μg/mL L-ascorbic acid 2-phosphate (both from Merck). After 24 h of CHIR99021 stimulation ...
-
bioRxiv - Biophysics 2021Quote: ... This mix included 98% unlabeled recombinant human E254N tubulin diluted in assay buffer containing oxygen scavengers (180 mg/ml catalase (C40, Merck) and 752 mg/ml glucose oxidase (22778.01 ...
-
bioRxiv - Cell Biology 2023Quote: ... 2020) containing 300 ng GST-tagged MP-GAP fragments and 200 ng recombinant human Aurora A kinase (Merck, 14-511), 1mCi of [gamma-P32]ATP (Hartmann Analytic ...
-
bioRxiv - Neuroscience 2023Quote: ... the affinity resin was prepared by incubating 100 µg of recombinant protein with 20 µl of nickel beads (PureProteome Nickel magnetic beads, Merck) in 50 mM Pull-Down Buffer PDB (Tris–HCl pH 7.4 ...
-
bioRxiv - Biochemistry 2024Quote: ... Affinity-purified recombinant TrK13 proteins (WT, C580Y, R539T and C580Y) or commercially purchased BSA (A7030) or lysozyme (L6876) (Merck, Germany), each at 10 µM concentration ...
-
Appropriate glycemic management protects the germline but not uterine environment in type 1 diabetesbioRxiv - Developmental Biology 2024Quote: ... The dose of COS (75-400 IU daily of recombinant follicle stimulating hormone (Gonal-F Merck or hMG Menopur, Ferring) was individualized to patient’s age ...
-
Appropriate glycemic management protects the germline but not uterine environment in type 1 diabetesbioRxiv - Developmental Biology 2024Quote: ... Ovarian follicle growth tracking was performed by scheduled transvaginal ultrasound examinations that lead to the planning timepoint for oocyte maturation triggered by administration of recombinant hCG (250 microgr SC Ovitrelle; Merck). Oocyte retrieval was carried out by transvaginal ultrasographically-guided follicular puncture 37 hours later.
-
bioRxiv - Neuroscience 2024Quote: ... #L-1516)/1:1000 rabbit/goat anti-PV (Swant, #PV27, #PVG-214)/ rabbit anti-ACAN (Merck Millipore, #ab1031), in block ...
-
bioRxiv - Molecular Biology 2020Quote: ... rabbit anti-SOH (07-2139, Merck), mouse anti-GAPDH (Merck) ...
-
bioRxiv - Cell Biology 2019Quote: ... Rabbit anti-p34-Arc/ARPC2 (Merck Millipore ...
-
bioRxiv - Developmental Biology 2022Quote: ... Rabbit Aquaporin 5 (Merck, 1:200), Rabbit ERG (Abcam ...
-
bioRxiv - Microbiology 2019Quote: ... sheep α-rabbit HRP (AP510P, Merck) and goat α-mouse HRP (STAR117P ...
-
bioRxiv - Molecular Biology 2019Quote: ... and rabbit anti-V5 (AB3792, Merck) antibodies were used ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit polyclonal anti-RNF213 (#HPA003347, Merck), mouse monoclonal anti-RNF213 (clone 5C12 ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit anti-DVL (Merck Millipore, ABD122), and rabbit anti-PLK1 (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... rabbit anti-DVL (Merck Millipore, ABD122), chicken anti-GFP (Abcam ...
-
bioRxiv - Microbiology 2022Quote: ... rabbit anti-pH2AX-Ser139 (JBW301, Merck), donkey anti-rabbit IgG Alexa Fluor 488-labeled (H+L ...
-
bioRxiv - Cell Biology 2022Quote: ... or Rabbit H2AX (Merck Millipore 07627) antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: ... rabbit anti-SP1 (Merck, 07-645), 1:1000 ...
-
bioRxiv - Plant Biology 2021Quote: ... Secondary antibodies (anti-rabbit (Merck, AP132P) or anti-mouse (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4C: Rabbit anti-Olig2 (Merck, AB9610), sheep anti-TGM2 (Novus Biologicals ...