Labshake search
Citations for Merck :
351 - 400 of 1814 citations for Aldosterone Chemiluminescent ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... using spin filters (Merck, Millipore, MWCO: 5 kDa).
-
bioRxiv - Neuroscience 2020Quote: ... 5% aluminum sulfate solution (Merck Millipore, ref. 1.00121) for 5 min ...
-
bioRxiv - Microbiology 2019Quote: ... Mounted cells were fixed in 5% glutaraldehyde (Merck) in 0.1 M cacodylate (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked with 5% BSA (Merck KGaA) in TBS (Merck KGaA ...
-
bioRxiv - Biochemistry 2020Quote: ... Slides were later stained with 5% Giemsa (Merck) for 4 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% DMSO and 5% normal goat serum (Merck) for 1 h at RT and incubated overnight with primary antibodies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... supplemented with benzonase (5 μL/g pellet, Merck) and incubated for 15 min on a shaking table ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were suspended in 5% BSA (Merck; #12659) in PBS and single cells were sorted using a BD FACSJazz system into wells of a 96-well cell culture plate ...
-
bioRxiv - Biochemistry 2023Quote: ... Fluorescein-labelled ssDNA substrate (5’[FAM]-pT50; Merck) was used in all SEC experiments to allow us to characterise complexes formed on DNA in the absence of any unwinding.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 5 % heat-inactivated horse serum (Merck), EGF (20 ng mL−1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). At least 3 independent experiments with at least 2 independent littermate MEF clones of each genotype and each sex were performed to measure DNA damage responses ...
-
bioRxiv - Cancer Biology 2023Quote: ... and/or 5 μg/ml 17β-Estradiol (Merck). Four independent experiments were performed.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml holo-transferrin (Merck, cat. #T0665), 5 ng/ml EGF (Merck ...
-
bioRxiv - Microbiology 2020Quote: ... Beads were transferred to Filter plates (Durapore PVDF membrane, Merck Millipore), washed extensively and eluted with SDS sample buffer (Eberl et al. ...
-
Discovery and Optimization of Inhibitors for the Pup Proteasome System in Mycobacterium tuberculosisbioRxiv - Microbiology 2019Quote: Thin Layer Chromatography (TLC) was performed using TLC plates from Merck (SiO2 ...
-
bioRxiv - Microbiology 2022Quote: ... Petri plate covered with a durapore membrane filter (Merck, Kenilworth, NJ) for an easy harvest of mycelia ...
-
bioRxiv - Microbiology 2019Quote: ... TLC plates (3 × 10 cm) (TLC Silica Gel 60 F254, Merck) were spotted by simply touching the end of a capillary tube containing fungal crude extract to the coated side of the TLC plates ...
-
bioRxiv - Cell Biology 2021Quote: ... were seeded onto plates coated with 0.1% gelatin solution (Merck-Millipore). Lin28a+ cells and conventional MuSCs cells were cultured in Matrigel-coated plates All cells were incubated at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... TLC was done on glass-backed Silica Gel 60 plates (Merck) with chloroform/methanol/water (10/10/3 ...
-
bioRxiv - Cell Biology 2022Quote: ... pre-coated silica gel plates (Merck TLC silica gel 60 F254). Spots were detected by a UV lamp under 254 nm or 365 nm wavelength ...
-
bioRxiv - Physiology 2021Quote: ... filtered through a 0.22 μm PVDF-based filter plate (Merck Millipore), and analyzed by LC-MS/MS ...
-
bioRxiv - Neuroscience 2021Quote: 293 cells were seeded in culture plates (Corning, Merck, Darmstadt, Germany) and incubated overnight at 37°C with 5% CO2 in DMEM (PAN Biotech ...
-
bioRxiv - Cell Biology 2021Quote: ... Thin layer chromatography (TLC) was performed on silica gel plates (Merck) with fluorescent indicator ...
-
bioRxiv - Genomics 2021Quote: ... Petri plate covered with a durapore membrane filter (Merck, Kenilworth, NJ) for easy harvest of mycelia ...
-
bioRxiv - Cell Biology 2022Quote: ... glass-bottomed plates (HPTLC silica gel 60, 10×10 cm, Merck). Pure standards of FA 6:0-NBD (Cayman Chemical ...
-
bioRxiv - Immunology 2022Quote: MultiScreen-HTS IP 96 wells filter plates (Merck Millipore, Darmstadt, Germany) were placed in 35% ethanol ...
-
bioRxiv - Cell Biology 2023Quote: ... flat-bottomed 96 well plates (Merck Life Sciences, Cat #: CLS3362-100EA) at 9,000 cells ...
-
bioRxiv - Microbiology 2023Quote: ... TLC plates (Silica gel 60, non-fluorescent, 0.25mm thick, Merck Millipore) were cut to a width that allowed ∼1cm between each lipid sample ...
-
bioRxiv - Neuroscience 2023Quote: NMG plates containing 10mg/ml final concentration of PTZ (P6500-MERCK) were prepared the day before the assay ...
-
bioRxiv - Immunology 2023Quote: ... Transfections were carried out in 6 well plates using GeneJuice (Merck) with 1 μg of plasmid DNA per well ...
-
bioRxiv - Microbiology 2023Quote: ... Plates were then sealed with Breathe-Easy sealing membrane (Z380059, Merck) and incubated in the Biospa 8 (Biotek ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Immunology 2019Quote: ... WEHI-345 (0, 5 or 10 μM) 23 or Z-YVAD-fmk (0, 1, 5 and 10 μM; 21874; Merck, Australia) for 1 hr prior to stimulation with H ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and host plants was assessed by extracting the compounds following [6] by immersing the samples for 5 min in 5 ml of hexane (99%, SupraSolv, Merck, Germany), followed by removal from hexane with entomological tweezers that were previously cleaned with hexane ...
-
bioRxiv - Molecular Biology 2019Quote: To evaluate microscopic features of the captured cells such as morphological types and possible alterations we then used another collection membrane directly stained with hematoxylin and eosin after fixation for 10 min in a fixation solution (100 mL of 70% ethanol, 5 mL of glacial acetic acid and 5 mL of 37% formaldehyde solution – all solutions are from Merck Millipore). Samples were hydrated with distilled water for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Immunology 2024Quote: ... the MFI-value was converted to ng/mL by interpolation from a 5-parameter logistic (5-PL) curve of reference standard using the MILLIPLEX® Analyst 5.1 software (The Life Science/Merck KGaA).
-
bioRxiv - Neuroscience 2020Quote: ... fillet dissections of L3 larvae or pharate adults were performed in modified HL3 solution ([HL3-EGTA] 70 mM NaCl, 5 mM KCl, 10 mM NaHCO3, 20 mM MgCl2, 5 mM trehalose (Merck KGaA, 108216), 115 mM sucrose (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by embedding in 5 % low melting agarose (Merck). Gelatinated blocks were washed in 0.1 M Soerensen’s phosphate buffer (Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5% (v/v) Donkey serum (Merck Millipore, S30-100ML) for more than 1h at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C and samples were eluted with 5 mM H2SO4 in water at a 0.3 ml/min flow rate.
-
bioRxiv - Genetics 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 80 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mg/mL Triton X-100 (Merck, X100). Solubilisation was carried at 4 °C for 20 min with mild agitation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ cyclic mono-phosphate (8-Br-cAMP, Merck B5386) and 1 μM medroxyprogesterone acetate (MPA ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% CO2 in MEM (Merck Life science UK limited) with 10% FBS ...
-
bioRxiv - Microbiology 2019Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C and samples were eluted with 5 mM H2SO4 in water at a 0.3 ml/min flow rate.
-
Efficient breeding of industrial brewing yeast strains using CRISPR/Cas9-aided mating-type switchingbioRxiv - Microbiology 2021Quote: ... was equilibrated with 5 mM H2SO4 (Titrisol, Merck, Germany) in water at 55 °C ...
-
bioRxiv - Biophysics 2021Quote: ... Gefitinib (Y0001813, Merck; used at 5 μM final concentration), SCH772984 (S7101 ...
-
bioRxiv - Neuroscience 2021Quote: ... pre-incubated for 30 minutes in 5% BSA (Merck) in PBS containing 0.05% Tween-20 (PBST) ...