Labshake search
Citations for Merck :
1 - 50 of 998 citations for Adenovirus Type 5 Particles CMV Luciferase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... 5 μm particle diameter (Merck) and a “reverse phase column” Acquity UPLC HSS T3 ...
-
Inositol depletion regulates phospholipid metabolism and activates stress signaling in HEK293T cellsbioRxiv - Cell Biology 2022Quote: ... 5 μm particle diameter (Merck, Darmstadt, Germany) and a “reverse phase column” Acquity UPLC HSS T3 ...
-
bioRxiv - Physiology 2023Quote: ... the adenovirus was purified using the Fast Trap Adenovirus Purification and Concentration Kit (Merck KGaA, Darmstadt, Germany). An adenoviral vector expressing luciferase (Ad-Luc ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Flash chromatography was performed on a Varian 971-FP flash purification system using silica gel cartridges (Varian, particle size 50 μm) or on glass columns using silica gel type 60 (Merck, particle size 230 μm, 400 mesh). All compounds were obtained as oils ...
-
bioRxiv - Bioengineering 2023Quote: ... 3.5 μm particle size, 100 Å pore size) connected to a ZicHILIC guard column (20 × 2.1 mm, 5 μm particle size) (Merck KgAA) a constant flow rate of 0.3 ml/min with mobile phase A being 0.1 % Formic acid in 99:1 water:acetonitrile (Honeywell ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 3.5 μm particle size, 100 Å pore size) connected to a ZicHILIC guard column (20 × 2.1 mm, 5 μm particle size) (Merck KgAA), with a constant flow rate of 0.3 ml/min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 3.5 μm particle size, 100 Å pore size) connected to a ZicHILIC guard column (20 × 2.1 mm, 5 μm particle size) (Merck KgAA), with a constant flow rate of 0.3 ml min−1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... A SeQuant ZIC-pHILIC (2.1×100 mm, 5-μm particle) column (Merck) used for chromatographic separation ...
-
bioRxiv - Biochemistry 2022Quote: ... using a ZIC-pHILIC (150 mm × 4.6 mm, 5-μm particle) column (Merck Sequant). A 15-min elution gradient was used (80% solvent A to 20% solvent B) ...
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... and a SeQuant ZIC-HILIC precolumn (5 μm particles, 20 × 2 mm) (Merck, Darmstadt, Germany) using a linear gradient of mobile phase A (5 mM NH4OAc in acetonitrile/H2O (5/95 ...
-
bioRxiv - Bioengineering 2020Quote: ... using a ZIC-pHILIC column (150 mm × 4.6 mm, 5 μm particle size, Merck Sequant). The data sets were processed using XCMS (peak picking) ...
-
bioRxiv - Microbiology 2022Quote: ... with a ZIC-pHILIC (150 mm x 4.6 mm, 5 μm particle) column (Merck Sequant). Analytes were separated using 20 mM ammonium carbonate in water (Optima HPLC grade ...
-
bioRxiv - Biochemistry 2021Quote: ... with a ZIC-pHILIC column (150 mm x 4.6 mm, 5 μm particle, Merck Sequant), as described previously (82) ...
-
bioRxiv - Cell Biology 2022Quote: ... a SeQuant ZIC-pHILIC (100 mm, 2.1 mm I.D. and 5 μm particle size, Merck, Germany) column was used ...
-
bioRxiv - Systems Biology 2019Quote: ... a SeQuant ZIC-pHILIC (100 mm, 2.1 mm I.D. and 5 μm particle size; Merck, Damstadt, Germany) column was used ...
-
bioRxiv - Microbiology 2021Quote: ... A SeQuant ZIC-pHILIC (2.1 × 100 mm, 5 μm particles) HILIC phase analytical column (Merck KGaA, Darmstadt, Germany) was used as a chromatographic separation column.
-
bioRxiv - Microbiology 2023Quote: ... separation was performed using a SeQuant zic-pHILIC column (150 mm × 4.6 mm, 5 µm particle size; Merck) at 25°C ...
-
bioRxiv - Immunology 2023Quote: Cells were infected separately with five different lentiviral transduction particles (at MOI = 5) containing five different shRNA species (Merck) specific for the mouse Flot2 gene (NM_008028 ...
-
bioRxiv - Microbiology 2024Quote: ... Chromatography was performed on an Agilent Infinity II 1290 HPLC system using a SeQuant ZIC-pHILIC column (150 × 2.1 mm, 5 μm particle size, peek coated, Merck) connected to a guard column of similar specificity (20 × 2.1 mm ...
-
bioRxiv - Microbiology 2024Quote: The chromatographic separation for metabolite profiling was performed using a SeQuant ZIC-pHILIC (2.1×100 mm, 5-μm particle) column (Merck) at 40°C ...
-
bioRxiv - Neuroscience 2021Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Neuroscience 2022Quote: ... we embedded the brains in 3-5 % oxidized agarose (Type-I agarose, Merck KGaA, Germany) and covalently cross-linked the brain to the agarose by incubating overnight at 4 °C in 0.5 – 1 % sodium borohydride (NaBH4 ...
-
bioRxiv - Cell Biology 2022Quote: mRFP was amplified from aleu-mRFP (65) using GAGGACGTCGACATGGCCTCCTCCGAGGACGTCATCA/ GTCCTCACTAGTTTATGCTCCAGTACTGTGGCGGCCC and inserted into the second multiple cloning site of PSF- CMV-CMV-SBFI-UB-PURO (Merck, #OGS597-5UG) using SalI/SpeI restriction digest and ligation ...
-
bioRxiv - Microbiology 2021Quote: ... For detection of particle incorporation virus supernatant was further concentrated by centrifugation at 4°C for 2h at 21000xg on 5% Optiprep (Merck), the supernatant was removed and pellet was resuspended and subjected to Western Blot analysis ...
-
bioRxiv - Immunology 2023Quote: CORA receptors were transduced into a previously described Jurkat-based reporter cell line (12) by addition of lentiviral particles in a MOI of 1 and 5 μg/mL Polybrene (Merck) using spinoculation ...
-
bioRxiv - Microbiology 2023Quote: ... A SeQuant® ZIC®-HILIC 5 μm particle size analytical column 150 x 4.6 mm (Merck KGaA, Darmstadt, Germany) and a Acquity UPLC BEH C18 column 1.7 μm particle sized analytical column 2.1 × 100 mm connected to an Acquity UPLC BEH C18 VanGuard Pre-column ...
-
bioRxiv - Cell Biology 2021Quote: Monodisperse 10-μm-diameter polystyrene particles (Merck) were suspended in PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... protected by a Supelco ColumnSaver particle filter (Merck) and a gradient of mobile phase A (5 mM NH4OAc in CH3CN/H2O (40/60 ...
-
bioRxiv - Systems Biology 2022Quote: ... Chromatographic separation was performed on either of the three columns: a ZIC-pHILIC column (Merck, 150 mm × 2.1 mm, 5 μm particle size), a reverse-phase C18 Kinetex Evo column (Phenomenex ...
-
bioRxiv - Microbiology 2021Quote: ... Firefly and Renilla luciferase activities were measured with a dual-luciferase reporter assay system from Merck Millipore as previously reported (Goueslain et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... and monodisperse 20- and 30-μm-diameter polystyrene particles (Merck) and filtered ≤40-μm ToyoPearl beads (HW-65S ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5×105 cells were grown until confluence in 0.2 mg/ml collagen-type I-coated 6 well plates (Merck, Darmstadt, Germany) and incubated in serum-free medium for 24 h with/without Dox treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... and Sera-Mag SpeedBead Carboxylate-Modified Magnetic Particles (Hydrophobic) (#GE24152105050350, Merck) for 10mins at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... collagenase type CLS II (Merck, Netherlands); 8-bromo-cGMP (BIOLOG ...
-
bioRxiv - Biochemistry 2024Quote: Trypsin (bovine pancreas, type I, Merck) needles were crystallised using seeded vapour diffusion conditions as previously described (Heymann et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... an α-luciferase antibody (Merck KGaA, Darmstadt, Germany) was used in a 1000-1 dilution in 5% (m/v ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293T-PalmGFP cells were transfected by LentiBrite RFP-LC3 Lentiviral particles (Merck) according to the instructions of the manufacturer ...
-
bioRxiv - Genomics 2021Quote: ... Type-VS Millipore membrane (Merck Millipore, #VSWP01300). 20 μL ElectroMAX DH10B competent cells (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: ... Type 1 water (Milli-Q, Merck Millipore).
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 2% sucrose (Merck KGaA; type number: 107687), and three drops of fresh yeast ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... with wild type cells added CK666 (Merck), an Arp2/3inhibitor ...
-
bioRxiv - Cancer Biology 2020Quote: ... together with CMV-lacZ (75 ng/cm2) to normalize for transfection efficiency based on CPRG (Merck) colorimetric assay ...
-
bioRxiv - Microbiology 2024Quote: Viral particles from CPE-positive cultures were recovered through 0.22µm filters (Millipore, Merck). From an aliquot of 140 μl of the supernatant ...
-
bioRxiv - Immunology 2023Quote: ... Cells infected in two independent attempts with non-mammalian shRNA transduction particles (Merck) served as controls ...
-
bioRxiv - Neuroscience 2022Quote: ... a SeQuant ZIC-pHILIC (100mm, 2.1mm I.D. and 5μm particle size, Merck, Damstadt, Germany) column was used ...
-
bioRxiv - Biophysics 2023Quote: ... concentrated virus particles were freshly thawed and diluted in phosphate-buffered saline (PBS, Merck, 806552 ...
-
bioRxiv - Immunology 2022Quote: ... type 2 and type 3 were mixed and subsequently concentrated using 10 kDa Amicon® Ultra Centrifugal Filters (Merck Millipore, Billerica, MA) to a nominal concentration of 10000-16000-32000 DU/mL.