Labshake search
Citations for Merck :
351 - 400 of 4638 citations for 8 chloro 10 3 dimethylamino propyl phenothiazin 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... the supernatants were replaced with 10% FBS DMEM supplemented with 1 μg/ml puromycin (Merck-Millipore) for 24 h ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 1 ul of FR1 forward primer set pools (10 uM per primer, provided by MERCK) using 25 ul of Q5 Hot Start Master Mix (2X ...
-
bioRxiv - Microbiology 2023Quote: ... the pellets were washed first with 1× BugBuster® (10× Protein Extraction Reagent Novagen® Merck), then twice with water and once with 50 mM NaH2PO4 (pH 8) ...
-
bioRxiv - Microbiology 2023Quote: ... cells were incubated for 1 hour with 10 µg/mL Calcofluor White M2R (CFW) (Merck KGaA). Cells were harvested by centrifugation (2,000 ×g ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP (1:2000) (Faix et al., 2001) or mouse monoclonal antibody against glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:1000; #CB1001-500UG, Merck (Darmstadt, Germany)) and anti-fascin antibody 5E2 (undiluted hybridoma supernatant) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the slides were rinsed three times with PBS and blocked for 1 hour at RT in blocking buffer made with 3% BSA (Merck Millipore, 0218072801) and 0.02% Triton X-100 (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... was dissolved in vehicle (Ringer solution; NaCl 140 mM, CaCl21.2 mM, KCl 3 mM and MgCl2 1 mM (Merck KGaA Darmstadt, Germany)) to a dilution of 5.5μg/μl ...
-
bioRxiv - Neuroscience 2020Quote: ... neurons were incubated with 8 units/ml Proteinase K from Tritirachium album (#P2308, Merck, Germany) in Tyrode for 5 min at room temperature ...
-
bioRxiv - Biophysics 2020Quote: HeLa or HeLa-YFP TSG101 cells were seeded into 8-well slides (EZ slides, Merck). At 24-hour post seeding ...
-
bioRxiv - Cell Biology 2021Quote: ... then induced to differentiate in culture medium supplemented with 8 µg/mL biotin (Merck, B4639), 8 µg/mL D-pantothenic acid (Merck ...
-
bioRxiv - Biochemistry 2023Quote: Mouse neuroblastoma N2a-APPswe cells were cultured in Millicell EZ SLIDE 8-well glass (Merck). After treatments cells were washed 3x with PBS for 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... Culture dishes and microscopy dishes were coated with 0.1% gelatin (CAS 9000-70-8, Merck) in phosphate-buffered saline 30 min prior to cell seeding ...
-
bioRxiv - Cancer Biology 2023Quote: ... virus at the MOI of 50 was applied with 8 μg/ml Polybrene (Merck Millipore). Virus-containing medium was replaced with medium containing puromycin (3.5 μg/ml ...
-
bioRxiv - Genetics 2023Quote: ... in 27 ml of ESC medium with 8 µg/ml Polybrene (Merck, TR-1003-G) and the lentiviral gRNA library ...
-
bioRxiv - Physiology 2023Quote: ... A Whatmann paper impregnated with 8 µL of pancreas porcine elastase solution (MERCK, E1250-100mg) was applied on the surface of the aorta and left in place for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: Mock or SINV WT-infected cells were plated on 8 wells LabTek slide (Merck Millipore), were fixed with 4% formaldehyde (Merck ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 mM HEPES and 10 mM NaN3 (both from Merck), was used as staining buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and isolated murine hepatocytes (muHEP) were seeded on rat-tail collagen (10 µg cm−1, Merck Millipore) coated well plates at a density of 0.1×106 cells per cm² ...
-
bioRxiv - Biophysics 2019Quote: ... 50 mM KCl for MalE and OppA) supplemented with 1 mM Trolox and 10 mM Cysteamine (Merck).
-
bioRxiv - Cancer Biology 2020Quote: ... metabolites were extracted from conditioned media by dilution (1:10) in ice-cold methanol (Merck, Darmstadt, Germany) containing 3-nitro-L-tyrosine [5 µM] (Merck ...
-
bioRxiv - Bioengineering 2023Quote: The toxins were biotinylated using a 10:1 molar ratio of biotinylation reagent (Innolink Biotin 354S, Merck) to toxin as recommended by the manufacturer ...
-
bioRxiv - Bioengineering 2024Quote: ... THP-1 macrophages on MadSurface were exposed to 10 ng/mL lipopolysaccharide (LPS, Merck Life Science NV) and 10 ng/mL recombinant human interferon-gamma (IFN-γ ...
-
bioRxiv - Plant Biology 2021Quote: ... 10 kDa (Merck), desalted with PD 10 desalting columns (Merck ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10% betamercaptoethanol (Merck)) and boiled at 95°C ...
-
bioRxiv - Immunology 2020Quote: ... 10% SDS (Merck), 35% glycerol (Merck ...
-
bioRxiv - Immunology 2020Quote: ... 10% glycerol (Merck), and 0.2mM PMSF (Merck ...
-
bioRxiv - Neuroscience 2024Quote: ... The tissue sections from the in vivo experiment were incubated with a rabbit primary antibody for GluR2/3 (Merck Millipore; AB1506; 1:200) overnight and then with a secondary goat anti-rabbit IgG (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2023Quote: ... spermidine or MB-3 treatment, C646 (Med Chem Express, #HY-13823, USA), spermidine (Med Chem Express, #HY-B1776, USA) or MB-3 (Merck, #M2449, USA) was dissolved in DMSO (Solarbio ...
-
bioRxiv - Neuroscience 2021Quote: ... and Pellet Paint Co-precipitant (Merck Millipore #69049-3). Genomic DNA traces were removed with DNA-free DNase Treatment and Removal Reagents (FisherScientific #AM1906 ...
-
bioRxiv - Bioengineering 2019Quote: ... molecular weight cut-off 3 kDa (Amicon®, Merck) to a concentration of 1 mg/mL as determined by Qubit Protein Assay Kit (Invitrogen™ ...