Labshake search
Citations for Merck :
501 - 550 of 1457 citations for 8 Bromo 6 chloro 2H chromene 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... and 0.36 U glucose-6-phosphate dehydrogenase (G6PDH) (G7877; Sigma-Aldrich/Merck) to each tube ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Genomics 2020Quote: ... Free nucleic acids were then digested with 60 units/ml Benzonase Nuclease (Merck) for at least 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... we tried to contrast the lysis stimulation by contemporarily adding tranexamic acid (Merck) at a final concentration of 100 μM ...
-
bioRxiv - Neuroscience 2019Quote: ... The peptides were acidified to a total concentration of 1% Formic Acid (Merck). Samples were cleaned up using OASIS sample cleanup cartridges (Waters ...
-
bioRxiv - Plant Biology 2021Quote: ... 0.5 g 2-(N-morpholino)ethanesulfonic acid (ULTRON grade, Merck KGaA, Darmstadt, Germany), and 5 g Gelrite (Duchefa) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The spectrum was collected after addition of 2,5-dihydroxybezoic acid matrix substance (Merck) using an UltrafleXtremeTM MALDI-TOF/TOF mass spectrometer (Bruker Daltonics ...
-
bioRxiv - Neuroscience 2021Quote: ... 10mM Hepes and 1% MEM amino acids (all obtained from Merck, Darmstadt, Germany). Cells were grown for two weeks ...
-
bioRxiv - Immunology 2020Quote: ... N’N’-tetramethyluronium-hexafluoro-phosphate (HBTU) and trifluoroacetic acid (TFA) were purchased from Merck Millipore (Merck KGaA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were split at 80% confluence using trypsin-ethylenediaminetetraacetic acid (trypsin EDTA; Merck), spun at 200 x g for 5 minutes to pellet and snap frozen in liquid nitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... and stop solution (0.16 M Sulfuric Acid (Merck cat. No. 7664-93-9)) were prepared in-house ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Glacial acetic acid and Acetonitrile used are of HPLC grade procured from Merck Millipore (Millipore Sigma ...
-
Caloric restriction prevents inflammation and insulin dysfunction in middle-aged ovariectomized micebioRxiv - Physiology 2023Quote: ... 400 µL of 1% 2-thiobarbituric acid (TBA; Merck, St. Charles, MO, USA), and 200 µL of 20% phosphoric acid and heated at 100 °C for 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected 24h post-transfection with 25μg/ml of mycophenolic acid (Merck) and 50μg/ml xanthine (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected 24h post-transfection with 25μg/ml of mycophenolic acid (Merck) and 50μg/ml xanthine (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... and counterstained with modified Harris Hematoxylin (Epredia) differentiated with 1% acetic acid (Merck) for optimal stain intensity ...
-
bioRxiv - Pathology 2023Quote: ... the slides were washed with acidified water (5 mL glacial acetic acid (Merck) in 11 mL distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... formic acid and IPA in HPLC grade were purchased from Merck (Darmstadt, Germany). Purified water was produced by Elga Purelab Ultra (Celle ...
-
bioRxiv - Cell Biology 2023Quote: ... the pH of milk was adjusted to pH 4.6 by hydrochloric acid (Merck) followed by centrifugation at 4000×rpm (Beckman ...
-
bioRxiv - Microbiology 2023Quote: ... and the protein concentration was determined by bicinchoninic acid (BCA) assay (Merck Millipore) and by UV-visible spectroscopy using an ε of 24 mM⁻¹·cm⁻¹ at 280 nm ...
-
bioRxiv - Plant Biology 2023Quote: ... 100 mM ascorbic acid) and filtered through a layer of Miracloth (Merck Millipore) for two times ...
-
bioRxiv - Neuroscience 2020Quote: ... neurons were incubated with 8 units/ml Proteinase K from Tritirachium album (#P2308, Merck, Germany) in Tyrode for 5 min at room temperature ...
-
bioRxiv - Biophysics 2020Quote: HeLa or HeLa-YFP TSG101 cells were seeded into 8-well slides (EZ slides, Merck). At 24-hour post seeding ...
-
bioRxiv - Cell Biology 2021Quote: ... then induced to differentiate in culture medium supplemented with 8 µg/mL biotin (Merck, B4639), 8 µg/mL D-pantothenic acid (Merck ...
-
bioRxiv - Biochemistry 2023Quote: Mouse neuroblastoma N2a-APPswe cells were cultured in Millicell EZ SLIDE 8-well glass (Merck). After treatments cells were washed 3x with PBS for 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... Culture dishes and microscopy dishes were coated with 0.1% gelatin (CAS 9000-70-8, Merck) in phosphate-buffered saline 30 min prior to cell seeding ...
-
bioRxiv - Cancer Biology 2023Quote: ... virus at the MOI of 50 was applied with 8 μg/ml Polybrene (Merck Millipore). Virus-containing medium was replaced with medium containing puromycin (3.5 μg/ml ...
-
bioRxiv - Genetics 2023Quote: ... in 27 ml of ESC medium with 8 µg/ml Polybrene (Merck, TR-1003-G) and the lentiviral gRNA library ...
-
bioRxiv - Physiology 2023Quote: ... A Whatmann paper impregnated with 8 µL of pancreas porcine elastase solution (MERCK, E1250-100mg) was applied on the surface of the aorta and left in place for 10 minutes ...
-
bioRxiv - Microbiology 2024Quote: Mock or SINV WT-infected cells were plated on 8 wells LabTek slide (Merck Millipore), were fixed with 4% formaldehyde (Merck ...
-
bioRxiv - Cell Biology 2020Quote: E(y)2 was PCR-amplified using primers 5’ - tttggatccccggaattcccgacgatgag-3’ and 5’-tttgcggccgcttaggattcgtcctctggc-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites BamHI and NotI
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...