Labshake search
Citations for Merck :
251 - 300 of 5474 citations for 8 BROMO 4 METHYLTHIO 7 PHENYLPYRAZOLO 1 5 A 1 3 5 TRIAZIN 2 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Bioengineering 2022Quote: ... Five μL of the sample were injected into a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... pericarp sections were incubated for 2 h in a 5% (v/v) Normal Donkey serum (NDS; Merck) blocking solution in MTSB ...
-
bioRxiv - Developmental Biology 2022Quote: ... slides were incubated with a solution containing 1/50 phalloidin alexa fluor 488 in PBST supplemented with 5% DMSO (Merck) and covered with parafilm (Bemis ...
-
bioRxiv - Cell Biology 2021Quote: ... Spleen cells isolated from the mouse with the best serum titre were fused with Sp2/0 cells in the ratio of 5:1 using polyethylene glycol (PEG) 3000 (#817019, Merck). 10 million cells of the fusion mix were combined with 2x 104 BALB/c peritoneal macrophages and seeded in a 96-well plate ...
-
bioRxiv - Cell Biology 2021Quote: ... LECs (1.5 × 105) were transfected with 25 pmol of target siRNA or non-target siRNA (MISSION siRNA universal control#1, Merck) using Lipofectamine RNAiMAX (Thermo Fisher ...
-
bioRxiv - Immunology 2022Quote: ... the sections were treated with 10% methanol in PB for 20 min and then incubated for 1 h at RT in incubation buffer: 5% normal donkey serum (NDS: Merck) and 0.2% Triton X-100 (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated overnight with an anti-GFP rabbit antibody (0.5 μg/ml) (Tamamaki et al., 2000) and an anti-Cre recombinase mouse monoclonal antibody (1:1,000; MAB3120, Merck Millipore). After a rinse ...
-
bioRxiv - Immunology 2023Quote: ... were transduced with respective CORA receptors in a multiplicities of infections (MOI) of 1 and 5 μg/mL Polybrene (Merck). Cells harboring the receptor were enriched by using biotinylated anti-EGFR antibody and anti-biotin microbeads (Miltenyi Biotec).
-
bioRxiv - Immunology 2023Quote: CORA receptors were transduced into a previously described Jurkat-based reporter cell line (12) by addition of lentiviral particles in a MOI of 1 and 5 μg/mL Polybrene (Merck) using spinoculation ...
-
bioRxiv - Microbiology 2023Quote: ... LB plates were seeded with the different cultures and Whatman n° 1 filter discs (6 mm) were impregnated with 5 μl of 30% (v/v) H2O2 (Merck) as previously described [31] ...
-
bioRxiv - Molecular Biology 2024Quote: ... The resulting cell pellet was freeze-thawed thrice and re-suspended to 10% (w/v) in a lysis buffer containing 5% (v/v) Polysorbate 80 and 20 U mL−1 benzonase (Merck). After 1 h incubation at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... Secondary antibodies (table 1) were added in 5% milk TBS-T and membranes were developed using ECL luminol kit (Merck) and chemiluminescence films (Amersham Hyperfilm ECL ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Genetics 2020Quote: ... Bone tissue was cut into 2-mm pieces and placed in PBS buffer containing 4% paraformaldehyde (Schuchardt, Muenchen, Germany) and 1% glutaraldehyde (Merck, electron microscopy grade ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with a cocktail of 1:100 phosphatase inhibitors cocktail 2 and 3 (Sigma/Merck, P5726-1ML and P0044-1ML, respectively) and 1:100 protease inhibitor cocktail (Sigma/Merck ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μm and 0.22 μm filter pore size (Fig. 5) (Whatman filter, Merck KGaA, Darmstadt, Germany) using sterilised filtration units (Nalgene ...
-
bioRxiv - Biochemistry 2021Quote: ... antipapain and pepstatin A) supplemented with 5 mM MgCl2 and 5 KU Benzonase nuclease (Merck Millipore). After incubation at 4°C for 30 minutes to assure the complete lysis ...
-
bioRxiv - Plant Biology 2019Quote: ... fresh stem sections were counterstained for 5 min by 5 µg/ml propidium iodide (PI, Merck) dissolved in tap water or 0.01 % Direct Red 23 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 5% FBS superior (Merck) and 2*105 units/ml Recombinant Human FGF-basic (PeproTech Inc.) ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 μM PD98059 (Merck Millipore), which target p38 and MEK1 ...
-
bioRxiv - Cell Biology 2022Quote: ... in 5% acetic acid (1.00063.1000; Merck). Membranes were blocked for 1 h at RT with 5% non-fat milk in PBS-T (1X PBS ...
-
bioRxiv - Pathology 2022Quote: ... for 5 minutes with pronase (MERCK, cat ...
-
bioRxiv - Microbiology 2019Quote: ... and 5% water in Acetone (Merck) overnight at -90°C in an Arctiko DP-80 cryo porter (Arctiko ...
-
bioRxiv - Microbiology 2021Quote: ... 250 μl of 5% glutaraldehyde (Merck) in 0.2M cacodylate buffer ...
-
bioRxiv - Neuroscience 2019Quote: ... Cyanine 5 (#SIC006-5X1NMOL, Merck AG).
-
bioRxiv - Cell Biology 2022Quote: ... and 5% ChemiBLOCKER (Merck Millipore, #2170) in 0.1 M NaP ...
-
bioRxiv - Neuroscience 2023Quote: ... bovine insulin (5 µg/mL, Merck) was added after 7 days in culture ...
-
bioRxiv - Microbiology 2023Quote: ... 5% bovine serum albumin (BSA; Merck) was added to cells for 60 minutes to reduce non-specific binding ...
-
bioRxiv - Microbiology 2023Quote: ... 5% formic acid (FA, Merck-Millipore) twice for 20 min ...
-
bioRxiv - Physiology 2023Quote: ... 5% donkey serum (Merck, Darmstadt, Germany) and 1% DMSO in PBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5% normal sheep serum (Merck). Incubation with primary antibodies was done for 12 to 72 hours at 8 °C in PBS-T with 3% BSA and 0.02% sodium azide ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μg/ml insulin (Merck, I9278), 100 μg/mL transferrin ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... absolute ethanol (Merck: 64-17-5), Oil-red-O (Sigma-Aldrich ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 5 μg/ml human insulin (Merck), and 50 μM hydrocortisone (Cayman ...
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... depending on manufacturer-suggested minimum seeding density) with lenti/retroviral supernatant in a 1:1 volumetric ratio and 8 µg/mL hexadimethrine bromide (Merck), before centrifugation at 900g for 30 min and returning to incubation at 37°C with 5% CO2 ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The lysate was supplemented with calcium chloride to a final concentration of 3 mM and chromatin was solubilised for 2 h at 4 °C by digestion with Turbonuclease (T4330, Merck) to a final concentration of 250U/ml ...
-
bioRxiv - Microbiology 2024Quote: ... and mixed 4 g of it in 8 mL of DMSO (Merck). The DMSO-soluble fraction of Enteropan was found to be 71.17% ± 3.07 ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Cell Biology 2020Quote: ... and Click-iT® EdU (5-ethynyl-2’deoxyuridine) Assay (BCK-EDU488, baseclick GmbH, Merck/Sigma-Aldrich, UK), respectively ...
-
bioRxiv - Biophysics 2023Quote: ... exposure was evaluated by a MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) test in a 96-well plate according to the manufacturer’s (Merck) protocol ...