Labshake search
Citations for Merck :
401 - 450 of 2834 citations for 8 3 5 DIMETHYL 4 METHOXYPHENYL 8 OXOOCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Products were separated on a LiChroCART 125-4 RP-18 end-capped 5 µm column (Merck, Darmstadt, Germany) with a solvent system of methanol and phosphoric acid (0.1% ...
-
bioRxiv - Genetics 2022Quote: ... 5 µg SA8 was dissolved in 10 µL 10 mM hydrochloric acid and digested with 20 ng/µL pepsin (Merck, cat. No. 10108057001) at 37 °C for 6 h ...
-
bioRxiv - Cell Biology 2023Quote: ... 200 μl of cell suspension was collected and mixed with 200 μl of ice-cold HBSS containing 5% fatty acid-free bovine serum albumin (BSA, Merck Millipore, 126575-10GM). To quench the fluorescence of non-internalized NBD-phospholipids ...
-
bioRxiv - Plant Biology 2023Quote: ... Acid digestion was performed by adding 9 mL of 69% nitric acid (HNO3) (Suprapur, Merck) and 1 mL of 30% hydrogen peroxide (H2O2 ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Biophysics 2019Quote: ... Fragments (2 mM in DMSO) were injected (2 μL) onto a Purospher STAR RP-18 end-capped column (3 μm, 30 × 4 mm, Merck KGaA). Chromatographic separation was carried out over a 4-min gradient elution (90:10 to 10:90 water:methanol ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant from late-log cultures was concentrated to <100 μL and washed (with 400 μL of ddH2O) in 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) using centrifugation at 5000 g ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells in IMDM+Glutamax medium were cryopreserved in liquid nitrogen until time of analysis complemented 1:1 with 80% FCS and 20% dimethyl sulfoxide (DMSO) (Merck).
-
bioRxiv - Cell Biology 2022Quote: ... 10 mM stock solution was prepared by dissolving ROCKi powder in 100% dimethyl sulfoxide (DMSO, Merck Life Science, UK, #D8418) and filtered through 0.22µM syringe filters ...
-
bioRxiv - Microbiology 2020Quote: Stock solutions of crude extracts and fractions were prepared at a concentration of 100 mg/ml in 10% dimethyl sulfoxide (DMSO - Merck).
-
bioRxiv - Microbiology 2023Quote: ... was dissolved at 10 mg/ml in dimethyl sulfoxide and diluted directly in broth. Sodium dodecyl sulfate (SDS; Catalog No. 428018) was purchased from Merck. Dispersin B was obtained from Kane Biotech (Winnipeg MB ...
-
bioRxiv - Molecular Biology 2024Quote: ... the cells pellet was resuspended with a freezing medium composed of 90% KSR and 10% of Dimethyl Sulfoxide (DMSO, #D2438, Merck). Cell vials were stored in a liquid nitrogen tank.
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Biochemistry 2024Quote: ... Ultrapure nitric acid was produced in-house from trace analysis grade nitric acid (Merck, Darmstadt, Germany) using a SubPur quartz sub-boiling distillation system (Milestone ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 100mM ascorbic acid (Merck Millipore). After four washes with TBS containing 0.5% Triton X-100 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... acid fuchsin (C.I.42685, Merck-Millipore), and azofloxine (C.I.18050 ...
-
bioRxiv - Neuroscience 2021Quote: ... Cyclopianozic acid (CPA, Merck-Sigma-Aldrich), a blocker of the sarco/endoplasmic reticulum Ca2+-ATPase pump (SERCA ...
-
bioRxiv - Biochemistry 2020Quote: ... all-trans-retinoic acid from Merck Millipore ...
-
bioRxiv - Cancer Biology 2020Quote: ... in 2 mM acetic acid (Merck), anti-mouse-CD3 (BD) ...
-
bioRxiv - Cell Biology 2021Quote: ... Acetic acid was purchased from Merck, US ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.1% (v/v) formic acid (Merck), incubated 15 min in an ultrasonic bath (VWR ...
-
bioRxiv - Pathology 2022Quote: ... acid fuchsin (C.I.42685, Merck-Millipore), and azofloxine (C.I.18050 ...
-
bioRxiv - Biochemistry 2019Quote: ... Fmoc-protected amino acids (Merck Millipore) and amino-modified acid-stable cellulose membranes with PEG-spacers (Intavis ...
-
bioRxiv - Synthetic Biology 2020Quote: ... amino-acid standards (Merck, Darmstadt, Germany) were analyzed under the same conditions in order to determine typical retention times.
-
bioRxiv - Synthetic Biology 2021Quote: ... Amino-acid standards (Merck, Darmstadt, Germany) were used to determine specific retention times.
-
bioRxiv - Microbiology 2020Quote: ... n-valeric acid (Merck, Darmstadt, Germany) and n-caproic acid (Carl Roth ...
-
bioRxiv - Cell Biology 2021Quote: ... Acetic acid was purchased from Merck, US ...
-
bioRxiv - Neuroscience 2020Quote: ... Triflic anhydride (trifluoromethanesulfonic acid anhydride, Merck/Sigma and sodium azide in analogy to the synthesis of AHA from Boc-Dab described by(Link et al. ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Ascorbic acid was obtained from Merck Ltd. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Amino acid standards (Merck, Darmstadt, Germany) were analyzed beforehand to determine typical retention times.
-
bioRxiv - Neuroscience 2023Quote: ... Flufenamic acid (FFA, Merck-Sigma-Aldrich) was first diluted in 100 mM DMSO and then in Low Ca+Co saline at a concentration of 100 μM ...
-
bioRxiv - Neuroscience 2023Quote: ... Cyclopianozic acid (CPA, Merck-Sigma-Aldrich) was diluted to 20 mM in DMSO and used at a final concentration of 20 μM in Low Ca+Co.
-
bioRxiv - Physiology 2023Quote: ... 200 μM L-ascorbic acid (Merck), and CaCl2 (to the final concentration of 1.8 mM) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2mM Ethylenediaminetetraacetic acid (EDTA, Merck).
-
bioRxiv - Developmental Biology 2023Quote: ... Retinoic Acid (RA; 0.5 µM, Merck) was added from day 90 to day 120 of differentiation ...
-
bioRxiv - Biochemistry 2022Quote: ... LC-MS grade formic acid (Merck), LC-MS grade water (Merck) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % non- essential amino acids (Merck) and GlutaMAX™ (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % non- essential amino acids (Merck) and GlutaMAX ™ (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 80 µM ascorbic acid (Merck). Fresh ascorbic acid solution in water was prepared every time and added to the click mix immediately before the start of click reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... and α-linolenic acid (L2376, Merck).
-
bioRxiv - Cancer Biology 2024Quote: ... 10 µM oleic acid (Merck, #O1008), or vehicles (0.05% DMSO and 0.02% ethanol) ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were mounted in CitiFluor™ CFM3 mounting medium (proSciTech, Australia) containing 3 μg/uL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Merck, Germany) to stain nucleic acids ...