Labshake search
Citations for Merck :
201 - 250 of 5468 citations for 7 methyl 4 methylidene 1 propan 2 yl 2 3 4a 5 6 8a hexahydro 1H naphthalene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... 0.01% 2-Mercaptoethanol) (Merck) and incubated at 95°C for 10 min following a previously published protocol (Dehesh et al ...
-
bioRxiv - Immunology 2023Quote: ... rotenone (2 μM; Merck) and antimycin A (2 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 2) Claret (Merck). The PKH-26 blasts were combined back with the claret LSCs and vice versa ...
-
bioRxiv - Microbiology 2023Quote: ... 2 M MgSO4 (Merck), 670 mM CaCl2 (Merck ...
-
bioRxiv - Microbiology 2023Quote: ... 2 M NaCl (Merck), 2 M KCl (Merck) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 M KCl (Merck), 2 M MgSO4 (Merck) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 mM EGTA (Merck), and 5 mM MgCl2 (Merck ...
-
bioRxiv - Cancer Biology 2023Quote: ... DLD-1 cells expressing different EPHB1 wildtype or mutant versions and EFNB1 were mixed in suspension at a ratio of 1:3 and plated at a density of 130,000 cells/cm2 on coverslips coated with 2 mg/cm2 of 1-2 mg/mL laminin (Merck KGaA, Germany, USA) and incubated at 37ºC in 5% CO2 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% streptomycin and 2 mM of Glutamax and 0.1 μg·ml−1 GDNF (#SRP3200, Merck) (Vyas et al. ...
-
bioRxiv - Neuroscience 2023Quote: For conditioning the odors 4-MCH (1:250, Merck, Darmstadt, Germany,CAS #589-91-3) and 3-OCT (1:167 ...
-
bioRxiv - Immunology 2021Quote: ... Inhibition of the TLR-4 pathway was achieved by treating cells with 2 µM TAK-242 (Merck) for 6 hours before adding particles ...
-
bioRxiv - Bioengineering 2022Quote: ... in Cytoskeleton Buffer (CB, 10 mM 4-Morpholineethanesulfonic acid,2-(N-Morpholino)ethanesulfonic acid (MES #M3671, Merck), 138 mM KCl (#6781 ...
-
bioRxiv - Developmental Biology 2019Quote: The multipotent mouse mesenchymal stem cells, C3H10T1/2 cells (Reznikoff et al., 1973) were cultured on 6-wells TPP plastic culture plates (Merck) or 6-wells Uniflex Flexcell plates (FlexCell Int ...
-
bioRxiv - Cell Biology 2023Quote: ... we seeded cells at 2 * 106 cells/ mL in S2 media in 2 mL media/ well in a 6-well plate with either DMSO (D2650, Merck), 2.5 μM CytD (C2618 ...
-
bioRxiv - Biochemistry 2024Quote: Mixing of lysozyme crystals (7×2 mm; grown by batch crystallisation) with 25 mM sulfanilic acid azochromotrop (SAA, Merck, lmax 505–510 nm), a highly absorbing red dye ...
-
bioRxiv - Microbiology 2020Quote: Cytotoxicity of the compounds were tested by use of a MTT [3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide] assay (Merck) at a final MTT concentration of 0.45 mg/ml or by use of a ATPlite Luminescence Assay System (PerkinElmer ...
-
bioRxiv - Molecular Biology 2023Quote: Cells of 2-3 days growth with approximately 70-90% confluency have been treated with Bortezomib (Merck, #504314) at 100 nM for 42 h ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Cell Biology 2020Quote: ... washed in PBS and incubated for 2 min in 2 mM H2O2 (Merck) at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... or 2-deoxy-glucose (2-DG; 500 μg/g) (25972, Merck Life Sciences) were injected IP at Day 0 ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells at a density of 5×105 /ml were supplemented with 2% dimethyl sulfoxide (DMSO; Merck) and the culturing was continued for another 24 to 72 hr ...
-
bioRxiv - Bioengineering 2022Quote: ... Five μL of the sample were injected into a C18 column (Merck Spherisorb ODS-2 (5 μm), 250×4 mm ...
-
bioRxiv - Plant Biology 2023Quote: ... pericarp sections were incubated for 2 h in a 5% (v/v) Normal Donkey serum (NDS; Merck) blocking solution in MTSB ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and phosphatase inhibitor cocktail 2 (1:1000) (Merck Life Sciences U.K. Ltd). Cell debris was removed from lysates via centrifugation (275 × g ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 % (v/v) 2-mercaptoethanol) and 25 U/mL Benzonase (Merck #70746).
-
bioRxiv - Neuroscience 2021Quote: ... 350 µl of a 1:100 dilution of 2-Mercaptoethanol (Merck, 8057400250), 250 µl insulin (Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit polyclonal anti-oligodendrocyte transcription factor 2 (Olig2) (Merck-Millipore, 1:200), rabbit polyclonal anti-ionized calcium-binding adapter 1 (Iba-1 ...
-
bioRxiv - Pathology 2023Quote: ... 1 µl of 10x TCEP (Tris(2-carboxyethyl)phosphine hydrochloride (#C4706, Merck) was added to the lid and mixed carefully ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Biophysics 2022Quote: The dyes used in this study and the working dilutions were: 6-Dodecanoyl-N,N-dimethyl-2-naphthylamine (LAURDAN, 4.5 μM, Sigma-Aldrich, Merck, #40227), Hoechst 33342 (80 uM ...
-
bioRxiv - Microbiology 2020Quote: ... 48 and 72 hours) of exposure to simulated solar radiation was performed by using 2’,7’-Dichlorodihydrofluorescein diacetate (DCFH-DA) (Sigma Aldrich-Merck KGaA, Darmstadtm Germany) solubilized in ethanol ...
-
bioRxiv - Biochemistry 2023Quote: ... 400 μg of AtLEGβ or papain were inhibited with 0.5 mM or 5 mM S-methyl methanethiosulfonate (MMTS, Merck), respectively ...
-
bioRxiv - Biophysics 2021Quote: ... 2 mM 2-mercaptoethanol) supplemented with a protease inhibitor cocktail (cOmplete, Sigma-Aldrich/Merck). Cell extracts were injected into a Ni Sepharose column for affinity chromatography purification followed by size exclusion chromatography of the RnlA-mutant–containing fractions as a final step ...
-
bioRxiv - Immunology 2020Quote: 2-5.105 cells were incubated for 2 h with different concentrations of H2O2 (Merck) or for 2 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 ml/well of overlay [MEM containing 2% FBS and 0.4% tragacanth (Merck, Israel)] was added to each well and plates were incubated at 37 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... Prepared solutions were mixed at 3:1 ratio with 20% α-cyano-4-hydroxycinnamic acid (Merck) solution in 20% ACN ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Plant Biology 2020Quote: ... 1 μL of each sample was injected into a Chromolith FastGradient RP 18-e column (50 x 3 x 2 mm; monolithic silica with bimodal pore structure, macropores with 1.6mm diameter; Merck) protected by a precolumn (Gemini NX RP18 ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 μL of the bacteriocin sample was loaded onto the trap column at 3% (v/v) ACN (Merck, USA) containing 0.1% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... The PDMS microstructures were then rinsed with 2:3 HEPES1/ethanol and with ultrapure water (Milli-Q, Merck-MilliPore). PVP (1.3 MDa ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Cell Biology 2020Quote: ... 1x phosphatase inhibitor 2 (Merck) and 1x phosphatase inhibitor 3 (Merck) ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli Rosetta 2 cells (Merck) by induction with 0.2 mM isopropyl β-d-1-thiogalactopyranoside for 18 h at 18 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... coli Rosetta 2 (DE3) (Merck) and purified using Glutathione Sepharose High Performance beads (GE Healthacare ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 mM glutamine (Sigma, Merck) and 1% penicillin-streptomycin (Pen-Strep ...
-
bioRxiv - Cell Biology 2021Quote: ... L-glutamine (2 mM; Merck), β-mercaptoethanol (50 µM ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg/ml U18666A (Merck) or vehicle (DMSO only ...