Labshake search
Citations for Merck :
101 - 150 of 5436 citations for 7 chloro 3' 4 6 trimethoxy 5' methylspiro 1 benzofuran 2 6' cyclohex 2 ene 1' 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), interleukin 1β (IL1β ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3 µM IWR-1 (MERCK, Cat. no. 681669). Glasgow’s MEM (GMEM)-based (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 Phosphatase Inhibitor cocktail 3 (Merck, P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Microbiology 2023Quote: ... LB plates were seeded with the different cultures and Whatman n° 1 filter discs (6 mm) were impregnated with 5 μl of 30% (v/v) H2O2 (Merck) as previously described [31] ...
-
bioRxiv - Neuroscience 2023Quote: ... The eluates 1-3 were mixed and concentrated with Amicon Ultra-15 (Merck Millipore, MWCO 3 K) to protein concentrations of 44–162 µM.
-
bioRxiv - Cell Biology 2020Quote: ... Smad3 inhibitor SIS3 (used at 6 μM; 1009104-85-1, Merck-Calbiochem), the inhibitor of JNK activity SB600125 (used at 20 μM ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... In the first tube, 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral transductions were performed in a 6-well plate format (3 × 105 cells/well) using 10 µg/mL polybrene (Merck Millipore). Stably transduced cells were flow-sorted.
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Systems Biology 2023Quote: ... after adding 1 mL of chloroform:methanol 2:1 (v:v) (Merck), the sample was vortexed at 1200 rpm for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Biophysics 2021Quote: ... Cells at 2-3 x 106 cells/mL were induced with 50 ng/mL doxycycline (Merck) and 5 mM valproic acid (Cayman Chemical) ...
-
bioRxiv - Immunology 2020Quote: ... 2-3 × 105 cells/well were plated in an ELI Spot plate (MAHAS4510, Merck Millipore, USA) and in vitro cultured for 18-24 hours in media supplemented with or without peptide at 0.5 µM (or ...
-
bioRxiv - Biochemistry 2020Quote: ... then supernatant concentrated to 2 mL using 3 kDa Amicon Ultra-15 Centrifugal Filter Units (Merck). Supernatant was then washed 3 times with 15 mL 10 mM ammonium acetate to remove residual erythromycin ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 3-(3,5-dioxo-1,2,4-oxadiazolidin-2-yl)-L-alanine (quisqualate) was purchased from Merck (Darmstadt, Germany). AF647-conjugated 9E10 antibody was prepared in-house as described previously (Cook et al. ...
-
bioRxiv - Immunology 2023Quote: ... or 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck).
-
bioRxiv - Cell Biology 2023Quote: ... TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’; obtained from Sigma-Aldrich/Merck) and non-targeting siRNA (Silencer® Select Negative Control No ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.4) (final concentration: 12mg/mL) containing 5 μL Benzonase (final concentration: 1 μL benzonase/mL (MERCK, 71205-3). After dissolving ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 μM 6-benzylaminopurine (BAP; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... excess media was removed from wells and mf were incubated with 0.5 mg/ml MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (Merck) in PBS at 37°C for 90 min ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to adding the cells.
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Molecular Biology 2019Quote: Inflorescences were harvested into fresh fixative (3:1 96% ethanol (Merck) and glacial acetic acid ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Developmental Biology 2019Quote: The multipotent mouse mesenchymal stem cells, C3H10T1/2 cells (Reznikoff et al., 1973) were cultured on 6-wells TPP plastic culture plates (Merck) or 6-wells Uniflex Flexcell plates (FlexCell Int ...
-
bioRxiv - Cell Biology 2023Quote: ... we seeded cells at 2 * 106 cells/ mL in S2 media in 2 mL media/ well in a 6-well plate with either DMSO (D2650, Merck), 2.5 μM CytD (C2618 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6), anti-GFAP (goat polyclonal ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.3 U hexokinase (Scientific Laboratory Supplies) and 1 U glucose-6-phosphase dehydrogenase (Merck) in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6) or 1:200 anti-oxytocin receptor (polyclonal rabbit ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 4.2) and 4-methylumbelliferyl-2-acetamido-2-deoxy-b-D-glucopyranoside (2 mM; #474502, Sigma-Aldrich/Merck). The reaction was stopped by 5 volumes of glycine and Na2CO3 ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 M urea (Merck), 1% sodium dodecyl sulfate (SDS ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% penicillin-streptomycin and 0.00035% 2-mercaptoethanol (Merck)) to an orbital shaker ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of 1 M DTT (Merck, D9779) was added and the sample was heated for 10 min at 70°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... the MEK1/2 inhibitor PD0325901 (1 μM, Merck), LDN-193189 (100 nM ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing 3-nitro-L-tyrosine [5 µM] (Merck, Darmstadt, Germany) as internal standard (ISTD ...