Labshake search
Citations for Merck :
351 - 400 of 1178 citations for 7 bromoquinoline 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 8-Hydroxypyrene-1,3,6-trisulfonic acid trisodium salt (HPTS) was purchased from Merck and used as received ...
-
bioRxiv - Biochemistry 2021Quote: All amino acids and resins were purchased from Novabiochem (Merck, Darmstadt, Germany) and Carbosynth (Compton ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... a buffer exchange to 0.1% formic acid (Merck Millipore, Burlington, MA, USA) was performed using centrifugal molecular cut-off filters (Merck Millipore ...
-
bioRxiv - Bioengineering 2022Quote: ... which was stopped through acidification with 5 μl of trifluoroacetic acid (Merck). Fifteen μg of each resulting peptide mixture were then desalted on Stage Tip (Rappsilber et.al. ...
-
bioRxiv - Plant Biology 2021Quote: ... and then by AWA (acetone/water/acetic acid 70:29.5:0.5) (Merck, Germany ...
-
bioRxiv - Cancer Biology 2019Quote: ... and formic acid (all analytical grade) were purchased from Merck (Darmstadt, Germany).
-
bioRxiv - Synthetic Biology 2020Quote: ... nucleic acids were digested by addition of 1 µL benzonase (Merck KGaA) and 10 µL 1 M MgSO4 followed by incubation at room temperature for 10 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2X of basal medium eagle’s amino acids solution 50X (Merck, Darmstadt, Germany) and 1X of minimal essential medium nonessential amino acid solution 100X (Merck) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 1X of minimal essential medium nonessential amino acid solution 100X (Merck). For culture of embryos with exogenous FGF4 ...
-
bioRxiv - Biophysics 2022Quote: ... HPLC-grade acetonitrile (ACN) and hydrochloric acid (HCl) were purchased from Merck and sodium-azide was procured from SD fine chemicals Ltd ...
-
bioRxiv - Cell Biology 2022Quote: ... and 44µl 90mM p- coumaric acid (Merck, #C9008-5G, solved in DMSO) dissolved in 1ml 1M Tris pH 8.5 ...
-
bioRxiv - Immunology 2022Quote: ... and 1 mM ethylendiamine tetraacetic acid (EDTA) (#EDS-100G, Sigma-Aldrich, Merck) in Ca/Mg-free PBS (#14190-169 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The reaction was quenched by adding formic acid (FA; Merck, Darmstad, Germany) to a final volume of 1% v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the supernatant was acidified with 100% formic acid (#1.00264.0100, Merck, DK). C18 stage tips (UltraMicroSpin Column ...
-
Chromatin priming elements direct tissue-specific gene activity prior to hematopoietic specificationbioRxiv - Genomics 2023Quote: ... 501µg/ml Ascorbic acid and 180⍰µg/ml Human transferrin (Merck, T8158)) and then plated onto non-adherent dishes (ThermoFisher ...
-
bioRxiv - Cell Biology 2023Quote: ... and 230 µl of the 9 mol/L sulphuric acid (Merck Millipore) was added and mixed ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfer was verified by PonceauS stain (0.1% Ponceau, 0.5% acetic acid, MERCK). The membranes were cut depending on the molecular weights of the desired proteins and rinsed in 0.1% TBS tween ...
-
bioRxiv - Biochemistry 2023Quote: ... sodium acetate and formic acid (FA) were obtained from Merck (Darmstadt, DE). Acetonitrile and 0.1% FA were obtained from Biosolve (Valkenswaard ...
-
bioRxiv - Microbiology 2022Quote: ... γ-aminobutyric acid (GABA) standard and deuterium oxide were purchased from Merck GmbH (Darmstadt ...
-
bioRxiv - Biochemistry 2023Quote: ... Methanol (MeOH) and formic acid (FA) were purchased from Merck (Darmstadt, Germany). Acetic acid (AA) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Gamma-aminobutyric acid (GABA, rabbit, 1:300, Sigma, Merck, Germany, A2052); anti-Green Fluorescent Protein (GFP ...
-
bioRxiv - Bioengineering 2024Quote: ... containing β-mercaptoethanol and lysed with acid-washed glass beads (G4649; Merck) using the Precellys® 24 instrument with liquid nitrogen cooling (Bertin Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells were incubated with 50 µM 17ODYA (17-octadecynoic acid, Merck) added from stock solution in DMSO or with 0.05% DMSO in DMEM containing 2% charcoal-stripped FBS and 30 mM HEPES for 4 h at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Pellets were then resuspended in 100 µL of 69% Nitric acid (MERCK) and digested O/N at RT ...
-
bioRxiv - Microbiology 2024Quote: ... Human Serum Albumin with or without fatty acids were purchased from Merck. IVIg (Multigam® 5%) ...
-
bioRxiv - Cancer Biology 2024Quote: ... stained with 0.057% Sulforhodamine B solution in 1% acetic acid (Merck, #230162) and washed twice with a 1% acetic acid solution in water ...
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Plant Biology 2021Quote: ... Individual sporophytes were subsequently transferred to GA-7 Magenta boxes (Merck Life Science UK Ltd., Dorset, UK) containing 100ml C-fern agar media when two fronds were visible (10-14 days old) ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Genomics 2023Quote: ... All sections from each sample were homogenised using a 7 ml glass Dounce tissue grinder set (Merck) with 8–10 strokes of a loose pestle (A ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...