Labshake search
Citations for Merck :
251 - 300 of 1036 citations for 7 Iodobenzofuran 5 sulfonyl chloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked with 5% milk (Merck) in PBS with 0.1% Tween 20 for 1 hour at room temperature and incubated in primary antibodies overnight at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml insulin (Merck, cat. # I6634), 5 µg/ml holo-transferrin (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ng/ml EGF (Merck, cat. #SRP3196), 50 nM dexamethasone (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... 5% glycerol) supplemented with Benzonase® (Merck) and cOmplete™ Mini EDTA-free protease inhibitor (Roche) ...
-
bioRxiv - Neuroscience 2020Quote: ... was transfected into COS-7 cells cultured in a well of 8 well chamber slide glass using GeneJuice Transfection Reagent (Merck Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... samples were resuspended in Urea 7 M and Thiourea 2 M buffer and desalted on Amicon Ultra-0.5 3 kDa centrifugal filters (Merck Millipore, Germany). Filters were filled to maximum capacity with buffers and centrifuged at 15,000 g for 10 min at 20°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and additional wells with 20% biotinylated PLL-g-PEG and FNIII(7-10) were supplemented with 1 µM staurosporine (Merck Millipore) to serve as a positive control for apoptosis ...
-
bioRxiv - Cancer Biology 2022Quote: ... The purified protein was dialyzed overnight in 25 mM Tris-Cl pH 7.5 using SnakeSkin®ialysis tubing (7 kDa molecular weight cutoff) and concentrated using Amicon™ Ultra-15 Centrifugal Filter Units (30 kDa molecular weight cutoff) (Merck) according to the requirements of the experiments.
-
bioRxiv - Microbiology 2022Quote: A CRISPR array containing 6 identical spacers targeting the tetR gene flanked by 7 repeats was cloned into pCDF-Duet (Novagen, Merck Millipore) by ligation after NcoI and SalI digestion ...
-
bioRxiv - Microbiology 2023Quote: ... The pre-cleared lysates were then incubated overnight at 4°C with polyclonal rabbit anti-TipR antibodies (1:400 dilution) (Kirkpatrick and Viollier, 2014) or monoclonal rabbit anti-HA antibodies (1:250 dilution) (Clone 114-2C-7, Merck Millipore). ...
-
bioRxiv - Neuroscience 2024Quote: ... for 5 x 7 min and incubated 2h at room temperature (RT) with blocking solution containing 10% normal donkey serum (NDS, Merck Millipore), 3% Bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2023Quote: ... The digested suspension was pelleted and the pepM extract buffer exchanged to PBS pH 7 using 10 kDa Amicon centrifugal filter unit (Merck, Ireland). PepM extracts were confirmed with SDS-PAGE and stored in solution at − 20°C.
-
bioRxiv - Microbiology 2023Quote: ... The flow-through was sterile filtered and concentrated to a final volume of 7 ml using Amicon Ultra-15 Centrifugal filter concentrator (Merck Millipore).
-
bioRxiv - Biochemistry 2022Quote: ... Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin, Bovine Serum, 12659, Merck Millipore) powder solved in 1 × TBST ...
-
bioRxiv - Microbiology 2019Quote: ... The pellet was dissolved in three ul distilled water and spotted onto 5×5 cm silica gel plates (Merck) using automatic TLC sampler ...
-
bioRxiv - Developmental Biology 2021Quote: ... The HPLC was equipped with a hydrophilic ZIC-pHILIC column (150 × 2.1 mm, 5 μm) with a ZIC-pHILIC guard column (20 × 2.1 mm, 5 μm, Merck Sequant). 5ul of each sample was used for each assay ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were starved overnight in serum-free DMEM and then treated for 1 hour with 5 ng/ml TGFβ1 (Preprotech) or with 5 μM SB431542 (Merck), and intensities quantified by ImageJ ...
-
bioRxiv - Microbiology 2022Quote: ... were washed with RPMI 2%G by applying 5 psi perfusion for 5 min using the CellASIC® ONIX2 microfluidic system (version 1.0.4 Millipore Merck). Yeasts were loaded into the CellASIC culture chambers by applying 8 psi for 5 s twice (Thomson et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... mature pollen was germinated on the surface of solid PGM (18% sucrose, 0.01% H3BO3, 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4 (Merck), pH 7.5 ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were incubated with Prussian’s blue solution containing ferrocyanide acid solutions (5% Hydrochloric acid (HCl) and 5% potassium ferrocyanide (Merck)) at a 1:1 ratio for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5 ml conditioned medium was centrifuged (5 min, 500g) and filtered through Amicon Ultra-0.5 Centrifugal Filter unit (Merck). Ammonia in TIFs and SCFs was then quantified using Dimension Ammonia assay (Siemens ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins in the serum were removed by passing it through a pre-rinsed (7 times washed) Amicon Ultra-2ml 3000 MWCO (Merck Millipore, USA) column ...
-
bioRxiv - Neuroscience 2020Quote: ... The cortices were homogenized mechanically in PBS by pipetting up and down with a 5mL plastic pipette, centrifuged (500 x g, 7 min, 4 °C) and resuspended in DMEM (Sigma-Aldrich, Merck, Switzerland) containing 5% FCS (Biochrom ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 50 µL benzaldehyde (BA) and 250 µL 3-octanol (OCT) (CAS 100-52-7, and 589-98-0, respectively; Merck, Darmstadt, Germany) were applied undiluted to 1-cm-deep Teflon containers of 5 and 14 mm diameter ...
-
bioRxiv - Molecular Biology 2021Quote: ... the protocol described by Choi et al.65 was applied using home-made wash buffer (50% formamide (Merck Millipore, 75-12-7), 5XSSC (Molecular Biology-P ...
-
bioRxiv - Microbiology 2022Quote: ... Five duplicate plates were spread individually by six gradient diluted soil suspensions from 10−2 to 10−7 dilution on 1/10 TSA medium (Tryptic Soy Agar, Merck, Darmstadt, Germany) and incubated under both aerobic and anaerobic conditions at 28 °C for two weeks ...
-
bioRxiv - Genomics 2023Quote: ... These assessments were conducted on 7-day old Foc strains cultured on petri dishes with potato dextrose agar (PDA; Merck, Darmstadt, Germany). An approximately 5 mm piece of the actively growing colony from each isolate was placed on PDA plates and incubated at 27°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Flies were raised at 25℃ and collected on the day of eclosion and kept in the dark for 7-10 days on the fly media containing 0.4 mM all trans-Retinal (Merck, St. Louis, MO). The experiments were performed with the “8-well” chamber (16 mm diameter x 10 mm height ...
-
bioRxiv - Cancer Biology 2024Quote: ... Two sets of four EV-rich fractions (7–12 and 16-22) were pooled and concentrated using Amicon Ultra-4 10 kDa centrifugal filter device (Merck Millipore, USA). Alternatively ...
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Microbiology 2022Quote: ... was prepared using 5× M9 minimal salts (Merck), diluted as appropriate ...
-
bioRxiv - Microbiology 2019Quote: ... For experiments using 5-FAM-rifampicin (Merck-Millipore), MLP or persistence phase cells were exposed to 1.5 µg/ml (concentration equimolar to 10x MBC rifampicin ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 µg/ml Apo-Transferrine (Merck, T2036). Explants were removed after 7 days once half of the membrane had been covered with keratinocytes and the culture was maintained by changing media every three days ...
-
bioRxiv - Immunology 2022Quote: ... 5 - 15 mM PEG-3000 (Sigma and Merck), 20 - 30 µM CA-074Me (Calbiochem) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Biophysics 2022Quote: ... using spin filters (Merck, Millipore, MWCO: 5 kDa).
-
bioRxiv - Neuroscience 2020Quote: ... 5% aluminum sulfate solution (Merck Millipore, ref. 1.00121) for 5 min ...