Labshake search
Citations for Merck :
251 - 300 of 1987 citations for 7 Chlorothieno 2 3 c pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Cell Biology 2019Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SC consisted of 0.7% yeast nitrogen base (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SCD-MSG medium consisted of 0.17% yeast nitrogen base without amino acids and ammonium sulfate (Formedium ...
-
bioRxiv - Microbiology 2021Quote: Peptides EcFtsN1-32-C and VmFtsN1-29-C were labelled with maleimide-Atto 495 (Merck Life Science UK). EcFtsA1-405 and VmFtsA1-396 were buffer exchanged into binding buffer (50 mM HEPES/KOH ...
-
bioRxiv - Microbiology 2021Quote: Peptides EcFtsN1-32-C and VmFtsN1-29-C were labelled with maleimide-Atto 495 (Merck Life Science UK). EcFtsA1-405 and VmFtsA1-396 were buffer exchanged into binding buffer (50 mM HEPES/KOH ...
-
bioRxiv - Cell Biology 2021Quote: ... ligation for 30 min 37 °C and polymerase reaction overnight at 37 °C according to manufacturer’s protocol (Merck, Duolink® In Situ Detection Reagents Red ...
-
bioRxiv - Microbiology 2023Quote: ... IL-2 (Merck), JQ-1 (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... and c-Fos (PC05; Merck; 1:200). Nuclei were visualized with 4’,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Microbiology 2022Quote: ... and Compound C were procured from Merck Millipore.
-
bioRxiv - Pathology 2023Quote: ... anti-surfactant protein C (SFTPC, AB3786, Merck), homemade anti-α-smooth muscle actin (clone 1A4 ...
-
bioRxiv - Plant Biology 2021Quote: ... Individual sporophytes were subsequently transferred to GA-7 Magenta boxes (Merck Life Science UK Ltd., Dorset, UK) containing 100ml C-fern agar media when two fronds were visible (10-14 days old) ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Genomics 2023Quote: ... All sections from each sample were homogenised using a 7 ml glass Dounce tissue grinder set (Merck) with 8–10 strokes of a loose pestle (A ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 4.2) and 4-methylumbelliferyl-2-acetamido-2-deoxy-b-D-glucopyranoside (2 mM; #474502, Sigma-Aldrich/Merck). The reaction was stopped by 5 volumes of glycine and Na2CO3 ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Neuroscience 2022Quote: 6-7 dpf zebrafish larvæ were deeply anesthetized using 0.2% Ethyl3-aminobenzoate methanesulfonate (MS222; Merck KGaA, Darmstadt, Germany) diluted in EM ...
-
bioRxiv - Immunology 2024Quote: ... ∼5,000 previously anti-dinitrophenyl (DNP) IgE-sensitized lung MCs (overnight at 1 µg/ml, clone SPE-7, Merck) were washed in Tyrode buffer (Merck ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C then moved to 37°C and incubated for 1 h with or without 100 µM cytochalasin D (Merck), 100 µM jasplakinolide (Abcam ...
-
bioRxiv - Cell Biology 2023Quote: ... the supernatants of lysed cells were incubated in shake tubes over 16 h at 4°C with c-Myc antibodies (9E10 M5546, Merck). Then ...
-
bioRxiv - Immunology 2024Quote: ... Clear whole-cell extracts were prepared by centrifugation at 20000g for 20min at 4°C and incubated with EZview Red Anti-c-Myc-Affinity gel (Merck) for overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µl T4 buffer and 2 µl 50% PEG4000 (Merck, Kenilworth, NJ). After incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µM epoxomicin and 50 µM (Z-LL)2-ketone (Merck Millipore) were added from stock solutions in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and rabbit anti-prosurfactant protein C (Merck, Germany)) both diluted 1:200 in 0.1% BSA and 0.1% Triton (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mM sodium pyruvate (Merck TMS-005-C), 2.5 g/L glucose (Sigma G8769) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mitomycin C (10 g/mL) (Merck, Darmstadt, Germany) was then used to treat the cells for two hours and using the tip of a 200 µL pipette ...