Labshake search
Citations for Merck :
51 - 100 of 4573 citations for 7 CHLOROTHIENO 2 3 F 1 3 BENZODIOXOLE 6 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:1000 Phosphatase Inhibitor cocktail 3 (Merck #P0044-5ML), 100 nM okadaic acid (Enzo LifeSciences #ALX-350-011-M001)) ...
-
bioRxiv - Genomics 2019Quote: ... and mixed with 1 volume of 1-bromo-3-chloropropane (Merck). Samples were spun (2min ...
-
bioRxiv - Cancer Biology 2022Quote: ... and functionalized by 200 µl of a 3% (v/v) solution of hyaluronic acid (HA) (Merck, Germany) at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
bioRxiv - Neuroscience 2024Quote: ... for 180 min prior to washing and development in Streptavidin-tertiary reagent (1:500 in 2% BSA and 0.1% Triton [TBS]) conjugated to either Cyanine 3 (Cy3) (Merck) or Alexa Fluor 488 (Life technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... 14-3-3 binding was detected using anti-GST monoclonal antibody (Merck).
-
bioRxiv - Cell Biology 2019Quote: ... Rac1/3 (23A8, Merck), Rac2 [6] ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3% hydrogen peroxide (Merck) was applied to the sections prior to incubation with HRP-conjugated secondary antibodies for 1h at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 µM TBTA (Merck), 3 µM Picolyl-Alexa647-Azide (Jena Bioscience ...
-
bioRxiv - Genomics 2022Quote: ... cells were passaged 1:3 using Accutase (Merck Millipore, #SCR005) in a single-cell suspension and seeded at 50000 cells/cm2 on 20 μg/ml laminin-coated 6-well plate ...
-
bioRxiv - Immunology 2020Quote: ... two STAT-3 inhibitors (STAT-3 inhibitor III (WP-1066) and STAT-3 inhibitor XIII (C-188-9) were tested (Merck, Sigma) and WP-1066 was used for infection studies at a final concentration of 12 μM ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-GCCCAAAGAATCAGAACAGATGC-3’) or the genomic 18S ribosome gene (mouse 18S forward: 5’-AAACGGCTACCACATCCAAG-3’, mouse 18S reverse: CAATTACAGGGCCTCGAAAG-3’) (Merck KGaA). Primers specific for mtDNA gives rise to a 201bp product ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... The corresponding GST fusion protein was added to a final concentration of 15 µg/ml in incubation buffer (10 mM Tris pH 8.0, 150 mM NaCl, 0.1 % Tween-20, 3 % BSA (fatty acid free, Merck)) ...
-
bioRxiv - Neuroscience 2023Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay was used to analyze the cell viability of SH-SY5Y cells ...
-
bioRxiv - Microbiology 2023Quote: ... 2–3 mL of stock solution was applied onto preparative TLC plates (glass, Merck, 20×20 cm ...
-
bioRxiv - Bioengineering 2023Quote: ... 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was purchased from Merck (Germany). The U-87 cell line was a kind gift from Esendagli Group at Hacettepe University (Turkey) ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNAs were chemically cross-linked to the membrane for 90 minutes at 65°C using 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Merck, Sigma Aldrich). The membrane was pre-hybridized for 30 minutes in Perfect Hyb plus (Merck ...
-
bioRxiv - Bioengineering 2021Quote: Three sender area squares (3 × 3 mm) were put into a 24-well containing 300 μL of anti-His antibody (Merck, Germany, NOVG70796-3) (10 μg mL−1 in DPBS ...
-
bioRxiv - Neuroscience 2023Quote: ... Two pulse applications of 3 µM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two pulse applications of 3 μM of GSK-3 Inhibitor CHIR99021 (Merck Millipore, 361571) were done on days 13 and 14 ...
-
bioRxiv - Neuroscience 2020Quote: ... Serum samples were deproteinized with acetonitrile (1:3; Merck, Cat# 1000292500), vortexed ...
-
bioRxiv - Molecular Biology 2019Quote: Inflorescences were harvested into fresh fixative (3:1 96% ethanol (Merck) and glacial acetic acid ...
-
bioRxiv - Pathology 2023Quote: ... 1:500 3-repeat tau (aa 267-316, 05-803, Merck). The PVDF membranes were incubated with primary antibodies at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... 3’-diaminobenzidine (DAB; Merck, Germany). DAB polymerizes in contact with H2O2 in the presence of peroxidase ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 (mouse monoclonal from Merck), GABA A Receptor γ (guinea pig polyclonal from SYSY) ...
-
bioRxiv - Microbiology 2022Quote: ... 3 gr/L (Merck, Germany); Na2HPO4 ...
-
bioRxiv - Microbiology 2020Quote: ... SU5402 3 μM (SML0443; Merck); and DAPT 10 μM (D5942 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM MgCl2 (#105833, Merck), 2 mM EGTA (Triplex®VI #108435 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Physiology 2022Quote: ... 3% BSA (A7030-10G, Merck) and 5% donkey serum (ab7475 ...
-
bioRxiv - Immunology 2023Quote: ... and 3% H2O2 (Merck, 216763). Fresh bleaching solutions were prepared and slides were bleached two times (15 min each ...
-
bioRxiv - Cell Biology 2023Quote: ... and 3% H2O2 (Merck – 216763). Fresh bleaching solutions were prepared ...
-
bioRxiv - Immunology 2023Quote: ... BAM-15 (3 μM; Merck), rotenone (2 μM ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 mM ATP (Merck, A2383), 2 mM GTP (Jena Bioscience ...
-
bioRxiv - Immunology 2023Quote: ... and 3% H2O2 (Merck, #216763,) for 3 rounds (15 mins each ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μM Chiron (Merck #SML1046), 1 μM PD 0325901 (Merck #PZ0162) ...
-
bioRxiv - Plant Biology 2024Quote: ... 3 kDa MWCO (Merck - UFC500324) and 0.5 µl were injected to LC-MS system ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3% sodium nitroprusside (Merck, S0501), 2.5% menadion (Merck ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with a cocktail of 1:100 phosphatase inhibitors cocktail 2 and 3 (Sigma/Merck, P5726-1ML and P0044-1ML, respectively) and 1:100 protease inhibitor cocktail (Sigma/Merck ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 400μL were mixed with 200μL of a 3 mg/mL collagen in 0.1% acetic acid solution (rat tail type I; Merck Millipore), followed by the addition of 10μL of 1 M NaOH ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 M NaCl using a 3 kDa MWCO Amicon Ultra Centrifugal Filter Unit (Merck Millipore) and mixed with tailless Xl histone octamer in the same buffer at a molar ratio 2:1 APLFAD-Δ:histone octamer on ice ...
-
bioRxiv - Developmental Biology 2023Quote: ... and blocked for 2 hours in PBS-T with 3% bovine serum albumin (BSA, Merck) and 5% normal sheep serum (Merck) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 μl, 5 mg/ml, Merck) was added to each well ...
-
bioRxiv - Molecular Biology 2019Quote: ... from an 18500g centrifugation (6 min at +4°C) were run through 3-kDa cut-off centrifugal filters (Amicon Ultra-0.5 ml, Merck) into pre-weighted collection tubes to remove remaining macromolecules ...
-
bioRxiv - Immunology 2022Quote: ... approximately 5×105 Calu-3 cells were pre-treated with kp7-6 (100 ug/mL, CD95/CD95L antagonist, Merck) for 2 hour and then infected with SARS-CoV-2 at an MOI of 0.2 ...