Labshake search
Citations for Merck :
401 - 450 of 3799 citations for 7 8 Dihydro 6H 1 6naphthyridin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The flow-through was sterile filtered and concentrated to a final volume of 7 ml using Amicon Ultra-15 Centrifugal filter concentrator (Merck Millipore).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... One milliliter of the virus supernatants was directly overlaid on the cells in the presence of polybrene (Merck, Germany) at a final concentration of 4 μg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... Blots were blocked in 5% w/v non-fat milk or 5% BSA (Albumin, Bovine Serum, 12659, Merck Millipore) powder solved in 1 × TBST ...
-
bioRxiv - Microbiology 2019Quote: ... The pellet was dissolved in three ul distilled water and spotted onto 5×5 cm silica gel plates (Merck) using automatic TLC sampler ...
-
bioRxiv - Developmental Biology 2021Quote: ... The HPLC was equipped with a hydrophilic ZIC-pHILIC column (150 × 2.1 mm, 5 μm) with a ZIC-pHILIC guard column (20 × 2.1 mm, 5 μm, Merck Sequant). 5ul of each sample was used for each assay ...
-
bioRxiv - Microbiology 2022Quote: ... were washed with RPMI 2%G by applying 5 psi perfusion for 5 min using the CellASIC® ONIX2 microfluidic system (version 1.0.4 Millipore Merck). Yeasts were loaded into the CellASIC culture chambers by applying 8 psi for 5 s twice (Thomson et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were incubated with Prussian’s blue solution containing ferrocyanide acid solutions (5% Hydrochloric acid (HCl) and 5% potassium ferrocyanide (Merck)) at a 1:1 ratio for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.5 ml conditioned medium was centrifuged (5 min, 500g) and filtered through Amicon Ultra-0.5 Centrifugal Filter unit (Merck). Ammonia in TIFs and SCFs was then quantified using Dimension Ammonia assay (Siemens ...
-
bioRxiv - Microbiology 2019Quote: ... Each sample was separated on 8% polyacrylamide gels and transferred onto 0.45 µm PVDF membranes (Merck, Darmstadt, Germany). PVDF membranes were blocked with PBS containing 0.05% Tween 20 (PBST ...
-
bioRxiv - Physiology 2019Quote: Chemotaxis of hMSCs was assessed using Boyden chambers with a pore size of 8 μm (Merck Millipore, PIEP12R48). Cells were seeded on the upper membrane in serum free α-MEM medium at a density of 30,000 cells/cm2 and allowed to adhere 4 h before being transferred to the wells containing chemotactant (Medium (serum free) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Equal amounts of protein were separated by 8-12% SDS-PAGE and transferred to PVDF membranes (Millipore-Merck). Membranes were incubated with primary antibodies ...
-
bioRxiv - Molecular Biology 2022Quote: ... 8 M urea and transferred onto a 30 kDa molecular weight cut-off column (Microcon-30, Merck Millipore). 150 μL 100 mM TRIS/HCl pH 8.5 ...
-
bioRxiv - Developmental Biology 2019Quote: ... The viral supernatant was mixed with 8 μg/ml DEAE-dextran and 1000 units/ml ESGRO (Merck Millipore) and added directly to the E14tg2a cells ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The protein samples were separated by 8% and 12% SDS PAGE and were transferred to PVDF membranes (Merck Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... thawed pellet was resuspended into 20 ml lysis buffer (0.025 M Tris pH 8; 0.5 M NaCl; 2 mM MgCl2; 100 U/ml Benzonase (Merck); 0.25 mg/ml lysozyme (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... before transduction of TREx BCBL1-Rta cells in the presence of 8 μg/mL of polybrene (Merck Millipore). Virus supernatant was removed 6 hours post transduction and fresh media added ...
-
bioRxiv - Neuroscience 2022Quote: ... as internal standard (IS) in 67% deionized water and 33% acetonitrile (ACN, 900667, CAS 75-05-8, Merck). The LTQ Orbitrap ELITE ETD (Thermo Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... ECD peak fractions were collected from pH 8 experiments and buffer exchanged using centrifugal concentration units (Amicon, Merck) into pH 6 purification buffer (50 mM MES ...
-
Preference of CAMSAP3 for expanded microtubule lattice contributes to stabilization of the minus endbioRxiv - Biophysics 2023Quote: ... pH 7.3) supplemented with 8% glycerol and 0.5 mM DTT using a 30-kDa-cutoff centrifugal filter (UFC503096; Merck). Finally ...
-
bioRxiv - Molecular Biology 2023Quote: ... Nuclear translocation of FLAG-ER-SAMD1 was induced by adding 200 nM 4-OHT (Merck; 68392-35-8) for 24 h.
-
bioRxiv - Biochemistry 2023Quote: ... pH 8) and concentrated to 30 mg/ml using an Amicon Ultra-15 Centricon (Millipore Merck, Darmstadt, Germany). Crystallization experiments were performed with ORYX8 pipetting robot (Douglas Instruments ...
-
bioRxiv - Plant Biology 2024Quote: ... 5.5 µL of enzyme solution (275 ng of Trypsin Gold, Promega V5280; and 8 units of Benzonase, Merck Millipore 70746 ...
-
bioRxiv - Cancer Biology 2024Quote: ... A total of 2 × 104 cells were cultured in an 8-well chamber slide (Merck Millipore, Massachusetts, USA) and then fixed with 4% paraformaldehyde in PBS buffer for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... Beads were then washed 2x in Tween wash buffer (5 mM Tris-HCl [Sigma], 0.5 mM EDTA [AppliChem], 1 M NaCl [Merck], 0.05 % Tween-20 [Sigma]) and 1x in H2O ...
-
bioRxiv - Biophysics 2020Quote: ... functionalized with either 100 μg/mL poly-D-lysine overnight for microglia cells or with 0.2 mg/mL fibronectin (FC010, Merck, 1:5 in PBS) for 2h at 37°C for fibroblasts ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then incubated in blocking solution (5% bovine serum albumin in PBST) for 60 min at room temperature and then incubated with anti-CB1R (Merck Millipore, 1:1000) in blocking solution overnight at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins in the serum were removed by passing it through a pre-rinsed (7 times washed) Amicon Ultra-2ml 3000 MWCO (Merck Millipore, USA) column ...
-
bioRxiv - Neuroscience 2020Quote: ... The cortices were homogenized mechanically in PBS by pipetting up and down with a 5mL plastic pipette, centrifuged (500 x g, 7 min, 4 °C) and resuspended in DMEM (Sigma-Aldrich, Merck, Switzerland) containing 5% FCS (Biochrom ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 50 µL benzaldehyde (BA) and 250 µL 3-octanol (OCT) (CAS 100-52-7, and 589-98-0, respectively; Merck, Darmstadt, Germany) were applied undiluted to 1-cm-deep Teflon containers of 5 and 14 mm diameter ...
-
bioRxiv - Molecular Biology 2021Quote: ... the protocol described by Choi et al.65 was applied using home-made wash buffer (50% formamide (Merck Millipore, 75-12-7), 5XSSC (Molecular Biology-P ...
-
bioRxiv - Genomics 2023Quote: ... These assessments were conducted on 7-day old Foc strains cultured on petri dishes with potato dextrose agar (PDA; Merck, Darmstadt, Germany). An approximately 5 mm piece of the actively growing colony from each isolate was placed on PDA plates and incubated at 27°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Flies were raised at 25℃ and collected on the day of eclosion and kept in the dark for 7-10 days on the fly media containing 0.4 mM all trans-Retinal (Merck, St. Louis, MO). The experiments were performed with the “8-well” chamber (16 mm diameter x 10 mm height ...
-
bioRxiv - Cancer Biology 2024Quote: ... Two sets of four EV-rich fractions (7–12 and 16-22) were pooled and concentrated using Amicon Ultra-4 10 kDa centrifugal filter device (Merck Millipore, USA). Alternatively ...
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Cell Biology 2019Quote: ... HUVEC primary cells were cultured in all-in-one ready-to-use Endothelial Cell Growth Medium (Cell application Inc. Merck). All reagents specific supplier and identifier are listed in the Resource Table.
-
bioRxiv - Developmental Biology 2021Quote: ... the ZP was removed enzymatically and each one morula from OCT42bKOeGFP and NT CtrlFSC were aggregated to a chimera using phytohemagglutinin (Merck) and cultured as described previously [40] ...
-
bioRxiv - Plant Biology 2021Quote: ... surface sterilized with 10% (v/v) bleach solution and plated on agar plates containing one-half strength Murashige and Skoog (MS) salts (Merck) pH 5.7 ...
-
bioRxiv - Neuroscience 2022Quote: ... Cat# AS1107) for one hour at room temperature and visualized using the Immobilon ECL substrate kit (Millipore, Merck KgaA, Germany). Primary antibodies specific to PLLP (1:700 ...
-
bioRxiv - Neuroscience 2021Quote: ... The cell medium was aspirated from the wells and fresh medium with one of the factors (Bafilomycin, 200 nM, Merck Millipore ...
-
bioRxiv - Microbiology 2020Quote: ... Materials from the organic and aqueous fractions were analyzed by one-dimensional TLC on a silica gel 60 plate (Merck) using a solvent system composed of chloroform:methanol:acetate:water (25:15:4:2 by volumes) ...
-
bioRxiv - Cancer Biology 2021Quote: Chromatin was isolated from 20 million cells using the Magna ChIP A/G Kit (One-day chromatin Immunoprecipitation Kits, Merck) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and the chloroform or water phases were separated by one-dimensional thin layer chromatography (1D-TLC) on high-performance TLC aluminum sheets (silica gel 60; Merck). For separation of lipids ...
-
bioRxiv - Immunology 2023Quote: ... isolated cells from WAT were counted using cell counting chambers (one-way Neubauer counting chambers, C-Chip, Merck, Darmstadt, Germany). Single-cell suspensions were first stained with viability stain (Zombie NIR fixable viability kit ...
-
bioRxiv - Biochemistry 2023Quote: Cancer cells were seeded at a density of 1,000 cells/ 100 μL complete medium into 96-well cell culture plates (#655180, Greiner bio-one, Merck KGaA). After 24 h ...