Labshake search
Citations for Merck :
101 - 150 of 5481 citations for 7 7a Dihydro 2 2 4 6 6 pentamethyl 1 3 benzodioxol 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 6 μl benzonase (27 units/μl, Merck) and 1 μl MgCl2 (2.5 mM final concentration ...
-
bioRxiv - Microbiology 2022Quote: ... 294 mg/L MgCl2(H2O)6 (Merck), containing 0.1% BSA (Sigma) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5mM K4Fe(CN)6 (Merck, Darmstadt, Germany), 0.1% NP-40 and 0.2% Na-deoxycholate (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5mM K3Fe(CN)6 (Merck, Darmstadt, Germany), 5mM K4Fe(CN)6 (Merck ...
-
bioRxiv - Pathology 2023Quote: ... and 0.3M glycine (#56-40-6, Merck) in PBS ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.2 μM Na2MoO4 (10102-40-6, Merck); and 40 μM ethylenediaminetetraacetic acid iron(III ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... dried tissue samples (in liquid nitrogen) were dissolved in 3:2:1 mixture of HNO3 (Merck, Germany), H2SO4 (Merck ...
-
bioRxiv - Developmental Biology 2022Quote: ... HUVEC were treated with 500nM 5-Aza-2’-deoxycytidine (MERCK) dissolved in 0.9% NaCl ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 250 μM IdU (5-Iodo-2’-deoxyuridine, Merck, I7125) as described in the text ...
-
bioRxiv - Genetics 2023Quote: ... and CldU 100 μM (5-chloro-2’-deoxyuridine, C6891, MERCK). Cells were embedded in agarose block and DNA was prepared and combed on silanized coverslips ...
-
bioRxiv - Immunology 2023Quote: ... or 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck).
-
bioRxiv - Cell Biology 2019Quote: ... cleared extracts were incubated 2h-6h at +4°C in an orbital shaker with anti-FLAG sepharose beads (M2 clone, Merck, A2220). Bound complexes were pelleted and 5x washed (Lysis buffer with 1M NaCl) ...
-
bioRxiv - Bioengineering 2019Quote: ... For experiments with inhibitors UC2288 (2, 4, and 10 µM) (Merck), LY294002 (5 µM ...
-
bioRxiv - Molecular Biology 2024Quote: ... fixed with 2% paraformaldehyde (PFA) in PHEM and washed once for 5 min at (RT) with 3% BSA (bovine serum albumin, Merck-Sigma, Germany) in Tris-buffered saline with 10 mM EGTA and 2 mM MgCl2 (TBSTEM) ...
-
bioRxiv - Microbiology 2022Quote: ... Five duplicate plates were spread individually by six gradient diluted soil suspensions from 10−2 to 10−7 dilution on 1/10 TSA medium (Tryptic Soy Agar, Merck, Darmstadt, Germany) and incubated under both aerobic and anaerobic conditions at 28 °C for two weeks ...
-
bioRxiv - Cell Biology 2019Quote: Pooled extracts of additional control pancreas (n=6) and plasma (n=6) of the experimental groups were filtered with a 30 kDa cut-off Microcon filter (Merck Millipore ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1% FCS (Biowest) and 2 mM CaCl2 and 2 mM MgCl2 (Merck) prior to adding the cells.
-
bioRxiv - Neuroscience 2022Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6), anti-GFAP (goat polyclonal ...
-
bioRxiv - Plant Biology 2023Quote: ... 0.3 U hexokinase (Scientific Laboratory Supplies) and 1 U glucose-6-phosphase dehydrogenase (Merck) in triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:1000 anti-glutamine synthetase (monoclonal mouse, Merck Milipore, MAB 302, clone GS-6) or 1:200 anti-oxytocin receptor (polyclonal rabbit ...
-
bioRxiv - Cancer Biology 2020Quote: ... as were CK5/6 (clone D5/16B4; Merck) and p63 (clone 7JUL ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Microbiology 2022Quote: ... 4-chloro-7-nitrobenzofurazan (NBD-Cl; Merck, 98%), 1-iodododecane (Merck ...
-
bioRxiv - Cell Biology 2021Quote: ... SV40 T Antigen (Ab-2) (Merck Millipore; DP02; 5 μg/ml). Secondary antibodies (all from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Treatment with 2 µM hydrogen peroxide for 5 min (H2O2; Merck) was used to induce DNA strand-breaks and oxidative damage ...
-
bioRxiv - Genetics 2022Quote: ... 90 μl 5 M NaCl and 2 μl Pellet Paint (Merck) was added to each sample ...
-
bioRxiv - Immunology 2023Quote: ... the mice were intranasally sensitized using 1 μg of 2′3′-cyclic GMP-AMP (cGAMP, 531889; Merck Darmstadt, Germany) and 1 μg of (HDM ...
-
bioRxiv - Neuroscience 2024Quote: ... for 180 min prior to washing and development in Streptavidin-tertiary reagent (1:500 in 2% BSA and 0.1% Triton [TBS]) conjugated to either Cyanine 3 (Cy3) (Merck) or Alexa Fluor 488 (Life technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... actin was let to polymerize in PBS for 30 min at room temperature before adding 4-(4,6-dimethoxy-1,3,5-triazin-2-yl)-4-methylmorpholiniumchloride (DMTMM, MERCK) cross-linker ...
-
bioRxiv - Molecular Biology 2023Quote: ... then the mixture was dialyzed against histone refolding buffer at 4 □ using a dialysis tube (D-TubeTM Dialyzer Medi or Maxi, MWCO 6-8 kDa, Merck). HE buffer (10 mM HEPES ...
-
bioRxiv - Biophysics 2021Quote: ... 6h) and purified using 100kDa Amicon ®Ultra centrifugal filters (UFC510096, Merck). DNA origami were stored up to 4 weeks at -20°C.
-
bioRxiv - Biophysics 2020Quote: ... 6h) and purified using 100kDa Amicon®Ultra centrifugal filters (UFC510096, Merck). DNA origami were stored up to 4 weeks at −20°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... resuspended in 6 μL deionized formamide (Merck Life Science) per hybridisation ...
-
bioRxiv - Biophysics 2021Quote: ... 6×His-tagged recombinant MSP1E3D1 (Sigma-Aldrich, Merck, USA) and FLAG-tagged recombinant mCardinal (kindly provided by Jakub Czapiński ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were treated with 6 mM CHIR99021 (Merck Millipore) in DeSR1 media containing DMEM/F12 1% MEM-NEAA (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... and finally dissolved in 6 M guanidine hydrochloride (Merck). 14.4.4 and H57 scFVs were refolded from inclusion bodies in vitro ...
-
bioRxiv - Neuroscience 2021Quote: ... Microtubule-Associated Protein 2 (MAP-2) (Merck Millipore Burlington ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% glucose + 2% D/L-lactate (Merck), or 2% D/L-lactate alone [31].
-
bioRxiv - Microbiology 2020Quote: ... In the first tube, 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral transductions were performed in a 6-well plate format (3 × 105 cells/well) using 10 µg/mL polybrene (Merck Millipore). Stably transduced cells were flow-sorted.
-
bioRxiv - Neuroscience 2024Quote: ... xylene (2 x 5 min) and coverslipped using Entallan mounting medium (Merck). Samples were imaged using an Olympus BX51 microscope equipped with an Olympus DP27 digital camera (Olympus Microscope Solutions).
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Molecular Biology 2019Quote: RNA for each biological repeat was extracted from 110 mg of rosette leaves number 5-6 (from at least six plants) with TRI Reagent (Merck) and rounds of phenol-chloroform and chloroform extractions followed by isopropanol precipitation ...
-
bioRxiv - Systems Biology 2023Quote: ... after adding 1 mL of chloroform:methanol 2:1 (v:v) (Merck), the sample was vortexed at 1200 rpm for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... Grids were then stained with 2% (w/v) uranyl acetate pH 4 (Merck) for 1 min ...
-
bioRxiv - Physiology 2024Quote: ... in trypsin (1mg/ml, Merck, UK, rocked at 4°C for 2 hours) followed by collagenase (type IV ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% penicillin-streptomycin and 0.00035% 2-mercaptoethanol (Merck)) to an orbital shaker ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl of 1 M DTT (Merck, D9779) was added and the sample was heated for 10 min at 70°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... the MEK1/2 inhibitor PD0325901 (1 μM, Merck), LDN-193189 (100 nM ...