Labshake search
Citations for Merck :
51 - 100 of 5816 citations for 7 3S 5S 3 Amino 5 methyl 1 piperidinyl 1 cyclopropyl 1 4 dihydro 8 methoxy 4 oxo 3 quinolinecarboxylic acid with 2 hydroxybutanedioic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: Starting reagents 3-hydroxybenzaldehyde 4 and hydrazine hydrate were purchased from Sigma-Aldrich and phenylacetic acid 1 was purchased from Merck. These reagents were used as received without further purification.
-
bioRxiv - Molecular Biology 2022Quote: ... or okadaic acid (1 µM, H2O) (Merck, Sigma) for 10 or 20 min in the absence of presence of insulin as indicated ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Molecular Biology 2023Quote: ... Authentic standards for the amino acids (Merck, Germany) were used for calibration and peak areas were normalized to signals of the internal standard (MES) ...
-
bioRxiv - Cell Biology 2023Quote: ... MEM non-essential Amino Acid (Merck, cat #M7145) and Normocin (Invivogen ...
-
bioRxiv - Neuroscience 2024Quote: ... buffer and amino acids were obtained from Merck| Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP, 11383221001, Merck-SIGMA). Sections were mounted using DPX (6522 ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2019Quote: ... 3-octanol (OCT; 1:1000; Merck) and 4-methylcyclohexanol (MCH ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, 1 µg/mL, Merck) in OWB-SDS at 4 °C overnight on a rolling mixer (30 r.p.m.) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A mixture (2:1 v/v) of (PFA 4% (Merck, 104005) in PBS 1X pH7.4):OCT (Leica Surgipath ...
-
bioRxiv - Neuroscience 2019Quote: ... 5% acetic acid (Merck), and dried using SpeedVac (Eppendorf) ...
-
bioRxiv - Cancer Biology 2024Quote: ... counterstained with 5µg of 4’,6-diamidino-2-phenylindole (DAPI – 1:1) (Sigma/Merck, D9542-10mg) to eliminate dead cells before running through the flow cytometer ...
-
P2RX7 inhibition reduces breast cancer induced osteolytic lesions - implications for bone metastasisbioRxiv - Cancer Biology 2022Quote: ... The cells were then stimulated with 100μM 2’(3’)-O-(4-Benzoylbenzoyl) adenosine-5’-triphosphate (BzATP; Merck Life Sciences, Gillingham, UK) to activate the P2RX7 ...
-
bioRxiv - Zoology 2022Quote: ... MEM Non-essential Amino Acid Solution (NEAA, Sigma, Merck), Glutamax (ThermoFisher) ...
-
bioRxiv - Zoology 2022Quote: ... MEM Non-essential Amino Acid Solution (NEAA, Sigma, Merck), Glutamax (ThermoFisher) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 0.15% 3-[(3- Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS, Merck Chemicals Ltd.). NADH:decylubiquinone (DQ) ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Cell Biology 2021Quote: ... pSmad1/5/8 (Merck, AB3848-I, 1/200), Ki67 (Cell Signaling Technology ...
-
bioRxiv - Genomics 2019Quote: ... and mixed with 1 volume of 1-bromo-3-chloropropane (Merck). Samples were spun (2min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% Trifluoroacetic acid (TFA, Merck), 1 M glycolic acid (Sigma) ...
-
bioRxiv - Cell Biology 2022Quote: ... the reaction was stopped by adding 1% formic acid (Merck), pH < 3 ...
-
bioRxiv - Microbiology 2022Quote: ... at 1 mg/mL in 63% of lactic acid (Merck), and from this stock we made a 1/30 dilution in distilled water (33 µg/mL in 2.1% of lactic acid) ...
-
bioRxiv - Immunology 2022Quote: Peptide samples were acidified by adding 1 % trifluoroacetic acid (Merck) and debris pelleted by centrifugation for 5 minutes at 14 000 × g ...
-
bioRxiv - Immunology 2019Quote: ... the inhibitor 6-amino-4–4-phenoxyphenylethylamino-quinazoline (Merck Millipore, USA) was reconstituted in DMSO at a stock concentration of 1mM and administered at a final concentration of 10nM on Days 0 and 4 ...
-
bioRxiv - Biochemistry 2019Quote: ... and csm5 were cloned into pACYCDuet-1 (5’-NcoI, 3’-XhoI; Novagen, Merck Millipore), csm4 was cloned into pEHisTEV (5’-NcoI ...
-
bioRxiv - Immunology 2020Quote: ... Amino acids were obtained from Novabiochem (Merck KGaA, Darmstadt, Germany). Peptides were purified using reverse phase preparative high-performance liquid chromatography (HPLC ...
-
bioRxiv - Immunology 2020Quote: ... Amino acids were purchased from Novabiochem (Merck KGaA, Darmstadt, Germany). N ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 µg/mL D-pantothenic acid (Merck, P5155), 1 µM rosiglitazone (Merck ...
-
bioRxiv - Plant Biology 2023Quote: Exogenous hormone treatments comprised 5 μM 1-napthaleneacetic acid (NAA; Merck Life Science UK Ltd., Gillingham, UK) (0.1% v/v Tween20) ...
-
bioRxiv - Cell Biology 2020Quote: ... Primary antibodies used were CYFIP1/2 (Sra-1/PIR121 [14], Rac1/3 (23A8, Merck), Nap1 [14] ...
-
bioRxiv - Neuroscience 2024Quote: ... 1-methyl-D-tryptophan (1-DMT; 1-LMT enantiomer, both Merck Life Sciences) for exploration of a possible tryptophan mechanism of immunosuppression ...
-
bioRxiv - Microbiology 2020Quote: ... Calpain 4 (1:500, MAB3083, Merck Millipore), Calpastatin (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Plant Biology 2021Quote: ... (+/-)-Abscisic acid (ABA, CAS No:14375-45-2), and Gibberellic acid (GA3, CAS No: 77-06-5) were purchased from Merck KGaA/ Sigma-Aldrich (Darmstadt ...
-
bioRxiv - Biochemistry 2023Quote: ... was incubated in 5 mM Tris-HCl buffer (pH 7.5) containing each substrate (1% glucomannan, Neogen, MI, USA; 1% polygalacturonic acid, Neogen; 1% carboxymethyl cellulose, Merck; 1% soluble starch ...
-
bioRxiv - Biophysics 2019Quote: ... Measurements were done in buffer A supplemented with 1 mM 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Trolox; Merck) and 10 mM Cysteamine (Merck).
-
bioRxiv - Biophysics 2019Quote: ... and 10 µM N-1-naphthylphthalamic acid (NPA, Sigma-Aldrich/Merck) for 3 weeks ...
-
bioRxiv - Biochemistry 2022Quote: ... 1% (w/v) fatty acid-free bovine serum albumin (BSA, Merck) and 1x EDTA-free cOmplete™ protease inhibitor cocktail (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... all sections were incubated in 1 % phosphotungstic acid (#100583, Merck Millipore) for 10 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... in 5% acetic acid (1.00063.1000; Merck). Membranes were blocked for 1 h at RT with 5% non-fat milk in PBS-T (1X PBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5% formic acid (FA, Merck-Millipore) twice for 20 min ...
-
bioRxiv - Biophysics 2023Quote: 1,2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphocholine (DOPC) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) stored in chloroform were purchased from Merck (Darmstadt, Germany) and stored under argon ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-cathepsin B (Abcam, ab92955, 1:1,000 and Merck, Ab-3 1:100) and anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: ... All samples were fixed 1:1 with 4% PFA (Merck, no. P6148) (final concentration 2% PFA ...
-
bioRxiv - Cancer Biology 2020Quote: ... in 2 mM acetic acid (Merck), anti-mouse-CD3 (BD) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.1 M 3-Isobutyl-1-methylxanthine (IBMX; Merck, 15679), 50 mM DAPT (Merck ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved caspase-3 (1:1000; AB3623; Merck Millipore, USA), and interleukin 1β (IL1β ...