Labshake search
Citations for Merck :
201 - 250 of 2517 citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... sections were fixed with 4% PFA and titrated to pH 5 using a buffer containing sodium acetate (Merck) and sodium tartrate-dehydrate (Merck) ...
-
bioRxiv - Molecular Biology 2022Quote: ... concentrated with an Amicon Ultra-4 centrifugal filter with a 5 kDa molecular weight cutoff (UFC8003, Merck Millipore), snap frozen and stored at -80 °C either directly (used for cryo-EM ...
-
bioRxiv - Microbiology 2024Quote: ... Products were separated on a LiChroCART 125-4 RP-18 end-capped 5 µm column (Merck, Darmstadt, Germany) with a solvent system of methanol and phosphoric acid (0.1% ...
-
bioRxiv - Neuroscience 2023Quote: ... 10-15 neurospheres and 4-6 organoids per cell line were rinsed twice with PBS and then lysed in RIPA buffer (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) supplemented with Protease Inhibitor Cocktail and Phosphatase Inhibitor Cocktail (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... + 3 μl benzonase (Novagen, Merck Millipore 70746-3), + 1 Roche complete protease inhibitor tablet) ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Immunology 2021Quote: ... Histone neutralisation experiments were performed via intraperitoneal injection with dialysed and combined a-Histone 3 and a-Histone 4 antibodies (Merck Millipore) or control polyclonal rabbit IgG (BioXCell) ...
-
bioRxiv - Biophysics 2019Quote: ... Fragments (2 mM in DMSO) were injected (2 μL) onto a Purospher STAR RP-18 end-capped column (3 μm, 30 × 4 mm, Merck KGaA). Chromatographic separation was carried out over a 4-min gradient elution (90:10 to 10:90 water:methanol ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was then concentrated to 100-200 μL using centrifugal filter units with a 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) by centrifugation at 5000 g at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the supernatant from late-log cultures was concentrated to <100 μL and washed (with 400 μL of ddH2O) in 3-kDa molecular mass cutoff (Amicon Ultra Centrifugal Filters, 4 mL, Merck Millipore) using centrifugation at 5000 g ...
-
bioRxiv - Cancer Biology 2021Quote: ... α6-integrin (Merck, monoclonal, MAB1378), Laminin V (Merck ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6% PEG 4000 (Merck-Schuchardt), pH 5.0 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ACV(9-[(2-Hydroxyethoxy)methyl]guanine) was obtained as a gift sample from Merck, India ...
-
bioRxiv - Biophysics 2021Quote: Fmoc (9-fluorenylmethyloxycarbonyl)-amino acids were obtained from Novabiochem (Merck Biosciences, La Jolla, CA). Rink amide MBHA resin (0.65 mmol/g ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Camptothecin (208925), rubitecan (9-nitrocamptothecin, R3655) and topotecan hydrochloride (T2705) were obtained from Merck Life Science.
-
bioRxiv - Cell Biology 2021Quote: ... and 200 µg/mL Hygromycin B (Merck Millipore, 400052). Two hours before imaging of HeLa cells with Doxycycline-inducible expression of untagged Cidec or Cidec-SUMOstar ...
-
bioRxiv - Microbiology 2019Quote: ... coli strain Rosetta-gami B (DE3) purchased from Merck Millipore (Merck Millipore ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1% trimethylchlorosilane (TMCS) (Cat. No. B-023; Merck & Co) and 30μL of pyridine (Cat ...
-
bioRxiv - Immunology 2021Quote: ... recombinant hepatitis B surface antigen (HBsAg) manufactured by Merck & Co. ...
-
bioRxiv - Immunology 2022Quote: ... amphotericin B deoxycholate (AmBD, Merck UK Ltd, Dorset UK), anti-Mala s 1 mouse monoclonal IgG1 antibody or mouse monoclonal IgG1 antibody isotype control was done by broth microdilution in a 96-well flat-bottomed plate (Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with 1 µM Latrunculin B (Merck) for 25 min.
-
bioRxiv - Plant Biology 2023Quote: ... or Rosetta-gami B strains (all from Merck Millipore) and purified using Pierce Glutathione Magnetic Beads (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2023Quote: ... supplemented with 10% FBS final (Merck, #ES-009-B). After washing twice with DPBS (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... cells were treated with 2LJμg/mL polymyxin B (Merck). Following staining ...
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... rat slices were exposed to 3 μM dihydroethidium (DHE) while in humans’ sections it was added 4 μM DHE (Merck, Darmstadt, Germany) for 30 minutes at 37ºC 51 ...
-
bioRxiv - Cell Biology 2023Quote: ... P1 virus was used to infect 50 ml of SF9 culture and P2 virus was harvested after 3-5 days through centrifugation and subsequent filtration through 0.45 μm PVDF membrane (Merck Millipore, SLHV033RS). P2 virus was either propagated further or stored at 4ºC in the dark ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... the remaining filtrate was first filtered over a 11-μm nylon mesh filter (Merck Millipore, USA) using the Merck™ All-Glass Filter Holder (47 mm ...
-
bioRxiv - Developmental Biology 2020Quote: ... The membranes were incubated separately with anti-Mmp-9 (1:1000, Cat# AB19016, Merck Millipore), anti-Vegf (1:200 ...
-
bioRxiv - Biochemistry 2021Quote: ... 9- 15- or 25-mer RNA (Integrated DNA Technologies) or 2.5 mM yeast tRNA (Merck) in the same buffer were added stepwise ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Commercial standards of OCFAs (Odd Carbon Straight Chains Kit containing 9 FAs, OC9, Merck, Germany) were converted into their FAMEs using the same method employed with the yeast samples ...
-
bioRxiv - Plant Biology 2023Quote: ... Acid digestion was performed by adding 9 mL of 69% nitric acid (HNO3) (Suprapur, Merck) and 1 mL of 30% hydrogen peroxide (H2O2 ...
-
bioRxiv - Microbiology 2020Quote: ... 5×106 cells from treated and untreated conditions were centrifuged for 5 min at 4,500 g and the pellets were resuspended in 4% paraformaldehyde (PFA, Merck, Germany), and incubated for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... For detection of particle incorporation virus supernatant was further concentrated by centrifugation at 4°C for 2h at 21000xg on 5% Optiprep (Merck), the supernatant was removed and pellet was resuspended and subjected to Western Blot analysis ...
-
bioRxiv - Biochemistry 2019Quote: ... Nuclei were pelleted by centrifugation at 3000 rpm for 5 min at 4°C and were resuspended in hypotonic buffer containing 1U/µl of benzonase (Merck). Extracts were incubated on ice for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... equipped with a LiChrospher® 100 RP-18 (125 mm x 4 mm, 5 µm) C18 reversed-phase column (Merck). The elution solvents consisted of ultrapure water with 0.1% formic acid (A ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... λem□=D525□nm) and l-α-phosphatidylethanolamine-N-(lissamine rhodamine-B sulfonyl) (ammonium salt) (PE-Rh-B) (fluorescent acceptor, λem□=□595░nm) (Merck KGaA, Darmstadt, Germany) in 1:7 DM ratio ...
-
bioRxiv - Microbiology 2021Quote: ... 6-hexanediol reagent (Sigma-Merck, 240117) were heated to 45°C and diluted to 50% in water as stock solution ...
-
bioRxiv - Bioengineering 2021Quote: ... 6% Ficoll PM-400 (Merck kGaA), 0.2% Sarkosyl (Merck kGaA) ...
-
bioRxiv - Cell Biology 2021Quote: ... for up to 6 days (Merck). The medium with the drug was renewed every 48 h.
-
bioRxiv - Bioengineering 2021Quote: ... 12 mg of Fast-Violet B Salt (F1631, Merck KGaA), and 2 mL of Naphthol-AS-MX ALP solution (855 ...
-
bioRxiv - Genomics 2019Quote: ... were pulse-labelled with 50 μM BrdU (Merck, B-5002) prior to recovery ...
-
bioRxiv - Bioengineering 2021Quote: ... Part B was made of 10U/mL human thrombin (Merck) in DMEM/F12 ...
-
bioRxiv - Microbiology 2019Quote: ... and solvent B (100% acetonitrile, Hypergrade for LCMS LiChrosolv, Merck) at a flow rate of 0.3 mL/min ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were treated with 1 μM Latrunculin B (Merck) or 0.02% vehicle (DMSO ...