Labshake search
Citations for Merck :
251 - 300 of 1794 citations for 6H Pyrano 3 2 g benzothiazole 8CI 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 1.335 g N,N-dimethylacrylamide (DMAA, #274135, Sigma-Aldrich now Merck) and 0.32 g sodium acrylate (SA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... magnesium chloride hexahydrate (MgCl2·6H2O, 203.30 g/mol) (Merck, Darmstadt, Germany), sodium hydroxide (NaOH ...
-
bioRxiv - Biochemistry 2023Quote: ... 2,000 g using Amicon Ultra Centrifugal filters 10,000 MWCO from Merck Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... India) or glucose (10 g L-1 D-glucose, Merck, Germany), under anaerobic condition ...
-
bioRxiv - Microbiology 2023Quote: ... We employed α-VSV-G antibody coupled to sepharose beads (Merck) for ChIP-seq of NusG-VSVG ...
-
bioRxiv - Microbiology 2023Quote: ... IL-2 (Merck), JQ-1 (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 4.2) and 4-methylumbelliferyl-2-acetamido-2-deoxy-b-D-glucopyranoside (2 mM; #474502, Sigma-Aldrich/Merck). The reaction was stopped by 5 volumes of glycine and Na2CO3 ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...
-
bioRxiv - Systems Biology 2021Quote: ... We used filter sizes of 3 kDa (Merck, Amicon Ultra-15 Centrifugal Filter Unit ...
-
bioRxiv - Cancer Biology 2020Quote: ... transferred on ice and benzonase (Merck, #71206-3) was added to degrade DNA at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 3% glutaraldehyde (Merck, 1042390250) in 0.1 M mNa-phosphate buffer (pH 7.4) ...
-
bioRxiv - Bioengineering 2022Quote: ... intralipid (2.08 v/v%; Merck, 68890-65-3) was used to mimic tissue-like scattering conditions and Nigrosin (0.62 v/v% of Nigrosin stock solution [0.5 mg/mL Nigrosin in deionised water ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 mM EGTA (cat. no. 324626, Merck) was used for 1 h pre-treatments ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 µL of Benzonase (Merck Millipore, US170664-3) was added and samples left on ice until an aqueous solution formed (30 min to 1 h) ...
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 U/mL benzonase (Merck KGaA, Darmstadt, Germany) per each mL of the original culture were added and the homogenate was incubated for 20 min ...
-
bioRxiv - Plant Biology 2023Quote: ... 4°C (Merck 3-16KL, KGaA®, Germany). Supernatant was collected and filtered through PTFE membrane filter (0.2 μm ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-hydroxy-3-methoxy-acetophenone (Apocynin, 73536, Merck), gp-91-ds-tat (AS-63818 ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Biophysics 2020Quote: ... 100 μl of 10 μg/ml recombinant protein G (Merck, Darmstadt, Germany) was added and incubated for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: Co-IP was performed using Protein G Immunoprecipitation Kit (Merck, Cat # IP50) as per the manufacturer's protocol ...
-
bioRxiv - Pathology 2022Quote: ... Then successively stained with 0.8% orange G solution (C.I.16230, Merck-Millipore) reacted for 10 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... Protein A and Protein G conjugated to HRP were purchased from Merck. DNA dye Hoechst 33342 was purchased from ThermoFisher Scientific and used at a final concentration of 5 μg/ml ...
-
bioRxiv - Microbiology 2019Quote: ... 80%) with 0.9 g di-lithium tetraboarate (Spectromelt A10, Merck, Darmstadt, Germany) using a Linn Lifumat ...
-
bioRxiv - Cell Biology 2019Quote: ... Polybrene (#TR-1003-G) and digitonin (#11024-24-1) were from Merck. 0.45μm low protein binding membrane (#28145-479 ...
-
bioRxiv - Cell Biology 2019Quote: ... Medium was supplemented with 8 μg/ml polybrene (Merck, #TR-1003-G) lacking penicillin/streptomycin ...
-
bioRxiv - Cell Biology 2021Quote: ... The main culture (TB medium: 0.9 L, 1.2 g/L NH4SO4 (Merck), 0.041 g/L KH2PO4 (Merck) ...
-
bioRxiv - Cell Biology 2021Quote: ... Conjugated goat-anti mouse immunoglobulin G (IgG)-horseradish peroxidase (HRP) (Merck, A4416) or anti-rabbit IgG (whole molecule)–peroxidase antibody produced in goat (MERCK ...
-
bioRxiv - Neuroscience 2020Quote: ... Thirty μl of PureProteome™ Protein A/G Mix Magnetic Beads (Merck) was washed in TBST and then incubated with 5 μl anti-HA antibody for 60 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein A and Protein G conjugated to HRP were purchased from Merck. DNA dye Hoechst 33342 was purchased from ThermoFisher Scientific and used at a final concentration of 5 µg/ml.
-
bioRxiv - Microbiology 2024Quote: ... and mixed 4 g of it in 8 mL of DMSO (Merck). The DMSO-soluble fraction of Enteropan was found to be 71.17% ± 3.07 ...
-
bioRxiv - Cell Biology 2020Quote: ... 1-524) was PCR-amplified using primers 5’ - tttcatatgggtgaagtcaagtccgtg −3’ and 5’-tttctcgagcatgtggaaatgcagttcccg −3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites NdeI and XhoI.
-
bioRxiv - Cell Biology 2020Quote: ... 468-1096) was PCR-amplified using primers 5’-tttggtaccgggccctggctgtgcctg-3’ and 5’-tttctcgagtgcggccgcagatcttag-3’ and subcloned into pET32a(+) vector (Merck Biosciences) in frame with 6xHis tag using restriction sites KpnI and XhoI.
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV titer was quantified using PCR (5′-TGA GTC ACC CAC ACA AAG GA-3′ and 5′-CCA AGC TGG CCT AAC TTC AG-3′) after proteinase K treatment (Merck Millipore). Under anesthesia with a mixture of medetomidine (0.3 mg/kg ...
-
bioRxiv - Cell Biology 2024Quote: ... The activation was achieved using 50 μL of the initial microbead’s solution following the two-step 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide (EDC)/sulfo NHS covalent coupling (Estapor carboxyl-modified dyed microspheres protocol, Merck Millipore) in MES buffer (30 min ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µl T4 buffer and 2 µl 50% PEG4000 (Merck, Kenilworth, NJ). After incubation ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 µM epoxomicin and 50 µM (Z-LL)2-ketone (Merck Millipore) were added from stock solutions in dimethyl sulfoxide (DMSO) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% Glucose (Merck; #1.08342.1000) as liquid medium].
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% Glucose (Merck; #1.08342.1000), either as liquid medium or supplemented with 2% Agar (Roth ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2% glucose (Merck) along with 2.5% (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM CaCl2 (Merck) including sequencing grade trypsin (Promega ...