Labshake search
Citations for Merck :
351 - 400 of 4344 citations for 6H Imidazo 4 5 1 ij quinolin 6 one 4 5 dihydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: The vessel lumen was washed 3 times with PBS ++ (PBS with 1mM CaCl2, 0.5mM MgCl2) and fixed with 4% paraformaldehyde (PFA, Merck, #30525-89-4) at 37°C for 15 min ...
-
bioRxiv - Plant Biology 2022Quote: ... The lysate was cleared by two centrifugations (4000 rpm, 10 min, 4 °C and 20000g, 10 min, 4°C) and filtered (Miracloth, Merck 475855-1R). The lysate (input ...
-
bioRxiv - Cell Biology 2023Quote: ... The cell lysates were centrifuged at 16,000 x g for 10 minutes at 4°C and the supernatants were then incubated overnight at 4°C with anti-Flag M2 affinity gel beads (Merck, Cat.N. A2220). M2 beads were then pelleted and washed three times with lysis buffer containing protease inhibitors ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were ultracentrifuged at 13000 rpm for 10 min at 4°C and concentrated to 1.5 ml using centrifugal filters (Merck, Amicon Ultra-4). They were then exchanged into buffer #5 overnight at 4°C and aliquoted and stored at -80°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Coverslips were mounted in MOWIOL 4-88 (Merck-Millipore). All steps were conducted at room temperature and in the dark post-secondary antibody addition ...
-
bioRxiv - Neuroscience 2021Quote: ... coverslipped with 20 μl Mowiol® 4-88 (Merck Life Science UK Ltd ...
-
bioRxiv - Biochemistry 2020Quote: ... and 4 μg of unconjugated mouse IgG2a (Merck #M5409) per 100 μL for detection of CD235a ...
-
bioRxiv - Plant Biology 2020Quote: ... followed by 4% (v/v) sodium hypochlorite (MERCK 1.93607.1021) containing 0.02% Triton X-100 for 3-min and rinsed three times with sterile distilled water ...
-
bioRxiv - Physiology 2021Quote: ... 0.004% (w/v) 4-hydroxybenzoate sodium salt (Merck, Germany)).
-
bioRxiv - Cell Biology 2021Quote: ... and with 4 μM CHIR99021 (Merck Millipore Sigma, USA) for one day ...
-
bioRxiv - Biophysics 2021Quote: ... and 4 mM of CaCl2 (Merck Life Science, Norway) (pH 7.8 adjusted with NaOH).
-
bioRxiv - Cell Biology 2022Quote: ... cultures were fixed in 4% paraformaldehyde (Sigma-Aldrich, Merck) for 30 min and washed in distilled water ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 and 3 kDa (Amicon Ultra-4, Merck Millipore) to fractionate the proteins according to their size ...
-
bioRxiv - Physiology 2021Quote: ... 0.004% (w/v) 4-hydroxybenzoate sodium salt (Merck, Germany)).
-
bioRxiv - Developmental Biology 2022Quote: ... 4 mg/ml bovine serum albumin (BSA, Merck, A3311), penicillin-streptomycin (75 U/ml-60 μg/ml ...
-
bioRxiv - Molecular Biology 2022Quote: ... filters were fixed in 4% paraformaldehyde (PFA; Merck, P6148) and permeabilized with 0.1% Triton X-100 (Merck ...
-
bioRxiv - Neuroscience 2022Quote: ... and sugammadex sodium (4 to 8mg/kg, i.v.; Merck Sharp & Dohme Corp. ...
-
bioRxiv - Neuroscience 2022Quote: ... Coverslips were mounted with Mowiol 4-88 (Merck Chemicals). For detection of Jacob-CREB and Jacob-LMO4 co-localization in STED imaging ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were then fixed with 4% paraformaldehyde (PFA; Merck) in PBS for 15 min ...
-
Identification of resistance mechanisms to small-molecule inhibition of TEAD-regulated transcriptionbioRxiv - Cancer Biology 2023Quote: ... cells were fixed with 4% paraformaldehyde (Merck life sciences) and stained with 1µg/ml DAPI (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... using 4 µM calcium ionophore A23187 (cat. C7522, Merck). The GSK484 concentrations were 1 µM ...
-
bioRxiv - Microbiology 2023Quote: ... Tyrosol [2-(4-hydroxyphenyl) ethanol] (Merck Ltd., Budapest, Hungary) was prepared as a 0.1 M stock solution in sterile physiological saline.
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were fixed with 4% formaldehyde (Merck, Sigma Aldrich) in PBS (phosphate buffered saline ...
-
bioRxiv - Neuroscience 2021Quote: ... then incubated overnight at 4°C with anti-KCC2 (1:200; Merck Life Sciences, Italy, #07-432) or anti-IGF-1R β (1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... was cultured in high-glucose (4.5 g × ml−1) Dulbecco’s modified Eagle’s medium (DMEM) containing 4 mM stable glutamine (Merck) and supplemented with 6% inactivated fetal calf serum (iFCS ...
-
bioRxiv - Neuroscience 2020Quote: ... samples were incubated overnight at 4°C with primary antibodies against puromycin (1:500, MABE343, Merck Millipore), βIII tubulin (1:500 ...
-
bioRxiv - Immunology 2020Quote: ... the cells were further cultured for 4 days in the same conditions plus Dexamethasone (1 μM; MERCK). IDCs were equally generated in 4 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated overnight at 4 °C with primary antibodies against puromycin (mouse monoclonal 1:500, Merck), Par3 (rabbit polyclonal 1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated overnight at 4 °C with an anti-puromycin antibody (mouse monoclonal 1:500, Merck) combined with an anti-β-actin antibody (rabbit polyclonal 1:1000 ...
-
bioRxiv - Bioengineering 2021Quote: ... hiPSCs were transduced with LV particles at MOI of 5 in the presence of 5 µg/mL of polybrene (Merck). Stably transduced cells were obtained upon selection with 0.3 µg/mL of puromycin for 6 days ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were washed with PBS and permeabilized for 5 min with 0.1% Triton X-100 in PBS and blocked with 5% ChemiBlocker (Merck-Millipore) in PBS for 30 min ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl of standards or samples were injected onto SEQuant ZIC-pHILIC column (Merck, PEEK 150 × 2.1 mm, 5 µm). MS analysis was performed in negative-ion mode over the mass range from 200 to 1,000 m/z ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Pathology 2023Quote: ... 95% and 100% ethanol solutions (5 min each) and subsequently washed twice in xylol (5 min each) and embed using Eukitt (#03989, Merck).
-
bioRxiv - Bioengineering 2023Quote: ... 30 mL Expi293 cultures were transfected with HER2 expression plasmid and the supernatant harvested 5-7 days later via centrifugation at 300 G for 5 minutes followed by filtration (Steriflip 0.22mm Merck, SCGP00525). HER2 was then purified from supernatant as previously described (Vazquez-Lombardi et al. ...
-
bioRxiv - Microbiology 2024Quote: ... 5 mM DTT and 5%(v/v) glycerol by five cycles of filtration through 10 kDa Amicon filters (Merck Millipore), and finally concentrated to 0.5 mg/ml.
-
bioRxiv - Molecular Biology 2021Quote: ... Chromatin corresponding to 13 μg of DNA was diluted 10-fold in RIPA buffer without SDS complemented with protease inhibitors and incubated overnight at 4°C with 4 μg of H3K9me3 or H3K27me3 antibodies (Frapporti et al., 2019) or with 4 μL of H3K4me3 monoclonal antibody (Merck Millipore #04-745). As input control ...
-
bioRxiv - Genomics 2019Quote: Cells were seeded at a density of 4 × 104 cells per well in laminin coated 4 well chamber slides (Millicell® EZ slide, Merck Millipore, PEZGS0816). Cells were washed in cold PBS and fixed using 4% paraformaldehyde (PFA) ...
-
bioRxiv - Microbiology 2022Quote: ... was prepared using 5× M9 minimal salts (Merck), diluted as appropriate ...
-
bioRxiv - Microbiology 2019Quote: ... For experiments using 5-FAM-rifampicin (Merck-Millipore), MLP or persistence phase cells were exposed to 1.5 µg/ml (concentration equimolar to 10x MBC rifampicin ...
-
bioRxiv - Immunology 2020Quote: ... 0.1 mg/mL 3,5,3’,5’-tetramethylbenzidine (TMB, Merck) and 0.003% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg H3K27me3 antibody (17-622, Merck-Millipore). For quantitative comparison of CTCF binding between WT and CTCF-AID cells ...
-
bioRxiv - Biochemistry 2020Quote: ... PBST/5% milk powder or ChemiBLOCKER (Merck KGaA). After further washing ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4NQO (CAS: 56-57-5) was from Merck Life Science (Espoo ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-HT (Serotonin creatinine sulfate monohydrate, H7752, Merck), m-CPBG (1-(3-Chlorophenyl)biguanide hydrochloride ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 5 µg/ml insulin (Merck, I5500), 1.8×10-4 M adenine (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 µg/ml Apo-Transferrine (Merck, T2036). Explants were removed after 7 days once half of the membrane had been covered with keratinocytes and the culture was maintained by changing media every three days ...
-
bioRxiv - Immunology 2022Quote: ... 5 - 15 mM PEG-3000 (Sigma and Merck), 20 - 30 µM CA-074Me (Calbiochem) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...