Labshake search
Citations for Merck :
201 - 250 of 3320 citations for 6H Furo 2 3 g 3 benzazepine 2 ethyl 7 8 9 10 tetrahydro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... thawed pellet was resuspended into 20 ml lysis buffer (0.025 M Tris pH 8; 0.5 M NaCl; 2 mM MgCl2; 100 U/ml Benzonase (Merck); 0.25 mg/ml lysozyme (Roche) ...
-
bioRxiv - Cancer Biology 2024Quote: ... A total of 2 × 104 cells were cultured in an 8-well chamber slide (Merck Millipore, Massachusetts, USA) and then fixed with 4% paraformaldehyde in PBS buffer for 15 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 mM CaCl2 and 2 mM MgCl2 (all Merck). The pH was adjusted to 7.3-7.4 (S20 ...
-
bioRxiv - Biophysics 2023Quote: ... 2-aminoethoxydiphenyl borate (2-APB) (Sigma-Aldrich/Merck, Germany), BL-1249 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were centrifuged (1500 g for 5 min at 4°C) and resuspended in 3 x PCV buffer A + 0.1% NP40 (Merck Life Science). After 10 further min on ice ...
-
bioRxiv - Neuroscience 2021Quote: Ethyl alcohol was purchased from Merck Chemicals (Darmstadt ...
-
bioRxiv - Neuroscience 2023Quote: Ethyl alcohol (Merck Chemicals, Darmstadt, Germany) was diluted in tap water to obtain a 20% (v/v ...
-
bioRxiv - Neuroscience 2023Quote: ... The homogenate was moved to 2 ml tubes and then 40% polysucrose 400 (P7798-100 g, Merck) in DPBS with calcium and magnesium was added in equal volumes for a final concentration of 20% ...
-
bioRxiv - Cell Biology 2021Quote: ... These Cas9-podocytes were transfected twice with two sgRNA targeting MATN2 (5’-GTCACGATCATTATGACCCG-3’; 5’-CTTGACCTTTGCATAGTCAT-3’; Merck) using RNAiMAX (Thermofisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... before Rab8a was washed 3 times with PBS in an Amicon filter (Merck Millipore, 10 kDa NMWL). Incorporation of label was confirmed by MS.
-
bioRxiv - Bioengineering 2023Quote: ... unreacted biotin-pentylamine was removed by ultrafiltration with a 3 or 10 kDa MWCO membrane (Merck Millipore). The recovered upper residual liquid (∼100 μL ...
-
bioRxiv - Microbiology 2021Quote: Cell viability and cytotoxicity of antibiotics and peptides were determined against human corneal epithelial cells (HCE-2, CRL-11135, ATCC, Manassas, Virginia, USA) using cell-counting-kit-8 (CCK-8) assay (Sigma Aldrich, Merck Life Science UK Limited, Dorset, UK) and lactate dehydrogenase (LDH ...
-
bioRxiv - Cell Biology 2019Quote: ... Medium was supplemented with 8 μg/ml polybrene (Merck, #TR-1003-G) lacking penicillin/streptomycin ...
-
bioRxiv - Microbiology 2024Quote: ... and mixed 4 g of it in 8 mL of DMSO (Merck). The DMSO-soluble fraction of Enteropan was found to be 71.17% ± 3.07 ...
-
bioRxiv - Molecular Biology 2019Quote: ... was washed 3 times with PBS (Merck Millipore ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... 3-Indoleacetic acid (IAA, auxin) (Merck, I2886) and 1-Naphthaleneacetic acid (NAA ...
-
bioRxiv - Neuroscience 2020Quote: ... were primarily fixed in 3% glutaraldehyde (Merck) in 0.1 M sodium phosphate buffer with pH 7.2 at 4°C for 1 h and stored in a 0.1 M Na-phosphate buffer at 4°C until further analysis ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... 3% sucrose (Merck KGaA; type number: 107687), and 30% apple juice (Edeka ...
-
bioRxiv - Immunology 2020Quote: ... Cells were fixed with 3% paraformaldehyde (Merck) and stained with anti-perforin Ab and phalloidin-AF 488 ...
-
bioRxiv - Immunology 2022Quote: ... Benzonase (15 U; Merck Millipore, 70664-3) and nuclease-free water served as positive and negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µg of calf histones (Merck; H9250) was added ...
-
Class IIa HDACs inhibit cell death pathways and protect muscle integrity in response to lipotoxicitybioRxiv - Cell Biology 2023Quote: ... 1S,3R-RSL 3 (Merck, Melbourne, Australia) and Ferrostatin (Selleckchem ...
-
bioRxiv - Cell Biology 2022Quote: IBMX (3-Isobutyl-1-Methylxanthin – 15879 - Merck) and lidocaine (L7757 – Merck ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.4 U/ml benzonase (Merck, #71206-3)) was added and cells were incubated at 4°C for one hour ...
-
bioRxiv - Genomics 2024Quote: ... scaffold and 3’-extensions (IDT or Merck). The pegRNA acceptor plasmid (Addgene #132777 ...
-
bioRxiv - Biochemistry 2022Quote: ... transferred and tris-(2-carboxyethyl)-phosphin (TCEP, Merck, Sigma-Aldrich, 646547-10×1ML) added up to 1 mM and cysteine reduction performed for 30 min at 60°C ...
-
bioRxiv - Neuroscience 2023Quote: ... and human recombinant FGF-2 (10 ng/ml; Merck Millipore, Burlington, MA, USA) as mitogens ...
-
bioRxiv - Cell Biology 2019Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SC consisted of 0.7% yeast nitrogen base (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% peptone (Becton Dickinson) and 2% glucose (Merck, Darmstadt, Germany). SCD-MSG medium consisted of 0.17% yeast nitrogen base without amino acids and ammonium sulfate (Formedium ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transduced with lentiviral particles in the presence of polybrene (8 g/mL, Cat# TR-1003-G, Merck); after 48 hours of transduction ...
-
bioRxiv - Microbiology 2023Quote: ... IL-2 (Merck), JQ-1 (Sigma Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 4.2) and 4-methylumbelliferyl-2-acetamido-2-deoxy-b-D-glucopyranoside (2 mM; #474502, Sigma-Aldrich/Merck). The reaction was stopped by 5 volumes of glycine and Na2CO3 ...
-
bioRxiv - Cell Biology 2022Quote: ... The corresponding GST fusion protein was added to a final concentration of 15 µg/ml in incubation buffer (10 mM Tris pH 8.0, 150 mM NaCl, 0.1 % Tween-20, 3 % BSA (fatty acid free, Merck)) ...
-
bioRxiv - Cell Biology 2022Quote: ... Fibers were washed 3×10 min in PBS and incubated in blocking buffer (1% bovine serum albumin (Merck), 5% goat serum (16210-064 ...
-
bioRxiv - Biochemistry 2023Quote: ... and centrifuging in 10 K (3 K for dA) ultra-centrifugal filters Amicon® (Merck KGaA, Darmstadt, Germany). This process was repeated five times to dialyze the ligand ...
-
bioRxiv - Molecular Biology 2024Quote: ... 8 µL proteinase K (10 mg/mL) and 8 µL of 1 M DTT (Merck) was added to the sperm fraction which were vortexed and incubated at 56 °C for 60 min (mock casework samples ...
-
bioRxiv - Microbiology 2022Quote: ... 10 g of NaCl (Merck, Mumbai, India) and 5 g of yeast extract (Himedia ...
-
bioRxiv - Microbiology 2023Quote: ... 10 g/L NaCl (Merck, Darmstadt, Germany), and 5 g/L yeast extract (HiMedia Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Neuroscience 2021Quote: ... and lysed directly in 15 µl 2x Laemmli buffer containing 10% 2-mercaptoethanol (Merck). Samples were loaded on a 4-to-20% SDS polyacrylamide gel (Bio-Rad) ...
-
bioRxiv - Physiology 2021Quote: ... a grid was briefly placed on 10 μL 2% uranyl acetate (w/v, Merck). Images were acquired under a JEM-1010 electron microscope (JEOL ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were further concentrated to 2-10 mg/ml using Amicon concentration devices (Merck, 3,000 Da ...
-
bioRxiv - Microbiology 2023Quote: ... 10 mM HEPES pH 7.2 (Merck, Darmstadt, Germany; CAS-No: 7365-45-9). TaC12 cells were washed with PBS and incubated with 1 mM PBS/EDTA (Merck ...
-
bioRxiv - Biophysics 2021Quote: ... and Desthiobiotin (71610-3) were purchased from Merck Life Science UK Limited ...
-
bioRxiv - Genetics 2021Quote: ... followed by 3 washes in KSOM (Merck Millipore) medium droplets ...
-
bioRxiv - Cell Biology 2022Quote: ... and Sf9 TriEx (71023-3, Novagen, Merck, UK) were grown at 28°C in a dry incubator without CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... and Control siRNA Luciferase: 5’ CGUACGCGGAAUACUUCGA 3’ (Merck). HeLa cells were transfected on two consecutive days with 20 nM Cav1 siRNAs using Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 mM 3-isobutyl-1-methylxanthine (Merck, I5879), 1 μM dexamethasone (Merck ...